Description :
Non Conding Region
Location :
Scaffold_1:77771- 77876
Sequence
105 bases(100 bases per row)
TTCTCCATGGATGCACCTGGGGTCGAGATGAAGTACCAGGTAGATATATCATGCAGGGAATCAACAGGTTTGTTATTGCCTACACTGAAGTTATGCTCTG
TTCTC