Description :
Non Conding Region
Location :
Scaffold_1:77648- 78528
Sequence
880 bases(100 bases per row)
CAACCAAGGCGACCGATCAAGAGTGAGGTACATACATTAGCAACCCGAGCTTTTGGTGcagcatgttgaagtgatctTGGAATTGGATGAACAGGAGAGC
GTCGAGTGTGGATGTAGCGCTGTGACGTGGTAAACCCTCGGGTTAGGAACGGAATGACCTCGCTAGTGAGGTGACGAGATGACTGCAGACACACCCGCAG
CTTGCCTAGCGCCAAGGTCACGAGGCGTGCGACGAGCGCATTAAATACAAGAAAAAAGACCCAACTTTTTAACGACAATGCTCGGCGATAGGAAGCCGCT
GTTTTGTGTCGCATTCTCGTGATTCAATCCGCTAACGCTAAGGAGCTCTCAAATGGCTGCTGCAAGAACAGGTTGTGTTGACTGGCTTGTGCTCAAAGGC
ACTGTCTTCGGTAGGAATTTCTCGGACAGCGCCAAACAGCACCATGACCCAACTTGGCAATGCGTCCGTCACCTACTGCACGTGCAGCGAAGTGTATAAT
AAACACTGTTGCGTTCGAGCAATGTTATCTCCAAGGGTATCGTTAGCATGCCTAAATTACACAACTACGTAAGCTTAAAGGTATCaccgcttcttccttc
aACTTCATTTCAAGTATCTTCAACGCCCAATGTCGGCAGCTGCTGGCTTACCTtccttctcgagcttcgcgGACTTCGGGAAGCGCTAAAAATTCTTGTG
GTTTTGATAATACCGGTAGCCATTCTGCAAATAAAAAGAAGGCATTTCCAAGATTGTAACACTTATTTTCAAGCCTGGTTCAATCCAGTGAGGATCTACA
CTGTACGGCAGCGCCGGTGAATGTGATCTTCCCGTTGTATTGTGCTTTTGGCAGCCTGCATCTATTAGCCCTTCCCTACC