Description :
Non Conding Region
Location :
Scaffold_1:776- 1161
Sequence
385 bases(100 bases per row)
CGCGTTTGCCACAAGAGCTGCCCGATGCGGTCTGTCGAGTGTGTCGATAGGAGACCAAGTCCCTTGGGCCTGCTCCAGACTTTTTTTCAATCTTTTTCAA
TCGGTGAAGCCCTACAACAGAAAGGGTTGTGAAAATGGTAATGGCTGGATGCTGACAAATGACAAATTCAAACATGGAGAATCAAGAGATGAGGTGTTTG
CAACGAGAGTGACCGACCGCACGGTAGTCAAGACGCAGACCACCACAGCACACATACTCGCCAGCCATGGTCCTCTGAGAATCGCTCGTTGTGCCTTGAT
ATTTCTGTGATTTCTTGTGGTTACATGGATATTCGAGTGCCCGTCGGACCTGCTTGCTCTCGACCTGCTTGTCTGCGTGCTGCAT