Description :
Non Conding Region
Location :
contig_1:77573- 78962
Sequence
1389 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGTTTGGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAAATTGCTCA
AATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTCGTACCGTG
AAGGAAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGGTAAATAA
AACTGTCTCGCCACTCACTCCCTCCTTTCAAGAAAATGCTTTACAATTGTGAGGGCTTTGACTACATGAAGTACAACGGACTATACTGCATCCCCGTCGA
GACAATTGTGTTCACGGGGTACCTCCTCGACTATGGTAACAACAGCAACGAAGCGTCTTCTGTGCTCACTCATTCAACAGTTTAATCTTGCGATGGCATT
TGGAAGCATGAAGATAAAAAGATAGCTCGTGCAATCCACGCCATCCAAATAACTGAACACGATAGCGCAACAATAAACCATTTGGTCAGCTTGAGGCTTG
AATTTACTCGCTTCCAAGTTATCAAATACTACAAGGGTTCATTGTTCACTTTAGAAAAATAGAACGCCATCGTAGACAGCGTTGGAGCTGAATGCGGTAC
ATGAAGAGACCCCGTCTCCAACATATCATATCAGTTTGTTTGCACTATCGACATAAAATATGAGAAGCGTCTAGAGTTTGCTAAAATAATACTATTTCTT
ATGAAAATACCAATAGTCTTTTTTTAATATTCTGCGTTCAAACCGCACTGCTCCAATATTTCTTCTGGAATGCCTGCCAGACAGGTATTGTCTTGCATTT
AGTACATAGCAAGTATCATATAATACATGTAGAAAGAGTAGACGGCTTCGTTCTGGGTCCCAAATGGAAATTGTAGATCAAAATGAGATCAAACTAGAAT
GCATCACCTTGTGTATGCCTTCACGACGTACTTCTCGTACATTAAAGTCGTAGGCAAGAAAGAAAGTGGGTGTTGCTTATTTCATGGGCTTAGCAAAACG
TGAAGCGAAGCGATAAACCGCACTCTTAAAGAATGATCCCACCAGTTGTTCAATGTCGACTGGCTGACAGCAGCCTTCTCTCCAAAACT