Description :
Non Conding Region
Location :
Scaffold_1:77429- 77790
Sequence
361 bases(100 bases per row)
catatcacatatttaccaccgaagatcgtcagcactgcagttatttatccagcaataacaccgagggatccccacatgtcatgggaggataatttacatc
agtagatgcaaaaaatggctcgcgtctcgacaggaatggagggaaatcattcaagggacacatacctttctcgccatcgtcgcttgtgcttatgctacag
gtcgaaaactgaaagtgacacgacacgcggagtgtaatcgtacttagttcagagtaagtacgatttttaaagcgtaccgattacgaccagttttaggctg
tatttttttgtctgtaaacgtacccacaatagctcccgattaagttacgatctgcaacgtg