Description :
Non Conding Region
Location :
Scaffold_1:77415- 77625
Sequence
210 bases(100 bases per row)
GTGAATGGAAAATGTGGATAACATTCAACTTACAACTCGCTAAGCAACCAGCCGCGAACAAACACCAAACGTGTCGTTGACTTGTGTGATTGTGGGAGTG
TTCAGCCGAGGTACCAGAAAGCAAGTTGCAACACAATAAACAACAGACGCGCCTGCGTCAGAAGAGAAAGATACTCCAAATCCCCAAGGTCGTTCGTTGG
CCGGCAATGT