Description :
Non Conding Region
Location :
Scaffold_1:77222- 77687
Sequence
465 bases(100 bases per row)
AGTTGAGTACAGACACGCTTTTCGTGCAGTCGAGGCTGCTCGACGCATGGATTATTTGCATTTTGGTAAATAAAATCTCAATTTGGCTGTCGTTTTGTTC
GTTTTGGTTGCTGTCTTTTCATAATTTCCTCAACTTTTTGTATTTTTTTATTTGCCAGCTTTTGATGAAGTTCACATTGCATGCTGGTTTTCTCAAAGTG
CCCGAGAAACAGTGTGGTACACACTAATCTGAGTAAGTGTAGCCTATTTTAGAAATTACCACACTATTTCAATCTTCATCACCTTCAAGTTCTTCTGCAA
AAAGAGAACACGAGGCGAGCAGACAGGTAGGTTGGCTATGCGTCTCTGTGTCTCTGTGTGTGTCTCTCTCTGCATTAGACGACCGTGCTCACCTGTGGCT
ACGTATACACGTGTACACTACGTGCTCTACTGAATAGAGCGTGACGACATTTCACACCACAGCGA