Description :
Non Conding Region
Location :
Scaffold_1:77090- 77328
Sequence
238 bases(100 bases per row)
AAAGAATGTTTACGTCTCTGTCGATGTTTGATAATGGACTAACGCTCTGTATCTTCTATCGATCGATCGAACGATATCGATCTTTTTGCACGTCCGACGT
GATGGCTTCGATGGCATTCGAACCGATCATCTGGTGACGTCATCCAGGTCAAAAACAACGGCAATATGTTGTAATATGCCGTTAACGGATACTTTCGTAT
CCTCAGTTCCCAATTTTCTTCAACGTCCATCTGCACCA