Description :
Non Conding Region
Location :
Scaffold_1:76903- 77685
Sequence
782 bases(100 bases per row)
GCCAAACAAAGAAGCGTCGAACACTTTGCGTAGCAAGCTGGAGAGAGTGTGATATAGCCGAAAGACTGAAGGTTCGTCAAAGCAGGGCAAGGTAAATCGC
CAACTGATCTCCACCCTCCGCTTTTTATGTCGCCTTTTCCTTTGCTGGCAGTTACTGCCACCGCTTTTCACTTTTCCTGTGCTCTTCGTATTCTCTCGCA
GTTTGAGAACGGGCGGGATTATTTTAAATGTTTCCTGCCTACTGTACCGAGTGTTCTCCGAAAAGTTTCCTTATCTTGCAGTGCGCGCAGATTCTTGGGC
CTTGGATCGCTTATGCTGAAGGAATTGCCGTTGAGTGTGCTGTGCCACTCTTGATTAGAGGTACTTAGGCGTCGTCTCAAAATTCAACCCATTGTCCACA
GCGTTGATCGGTGTCCTAAGTTGTTACTACATCATAAGCAAATCTAAACTCAGCTTTATGTGCAAAGCATACAGTCTCTGCATTGATATCACCAAGATGG
GCACGCTGATGACATTTCTTTTAAAAATTTGTTATCGACAGATAATCGCACTCATATCACTCACTCTTCAGACATCGTCTTGGGCAACACACGTCCCGTG
CTTATGCCACCCCCTTGACCATTAATACATGTAATAGTCGTCTGAATCCGACGAATCTGAGTTGTCCGACTAGCTTCTGTACCATTGCTTCGTGTGGACG
ATACTCGACGAGGGCACTTTGTTCAGAATCAAGTACTCGCTGGAAAACACGCTCGGATCTCGATTAAGATAAACGCCCAATC