Description :
Non Conding Region
Location :
Scaffold_1:76855- 77886
Sequence
1031 bases(100 bases per row)
TGAAGCCTCTCAAGCAAATTAGAGTAGTAGTAATACACCAGTGCGTTTGCGAATGTATCGCCGTGAAAGCTTCAACAAACCTCATTGCAAACTTGGAAGC
CCCGGTCATATTGCATCGGTCATTCATTCAAAAAGCGTTATCATTGCGTACACGCTAAGGCCGTAGTTGCTCATCCAGTTCGAGTTCATACACTAGAGAG
TTTCCACAACTCGACATGATCAAGTCAGCTGTCATTGAACGCGGGCTTGCATGCAGCAGAAATAGTCGACGTAGCTAGTGAGGTCGCACGCGGTGGTCAT
GGTGTTCACTCTGATAGCCAGGCCCACCGTAGCGATCCATTTCGTCCGGATGCATGCGTCCCCTGCGACCGCTATTGCCACGATCCCAGTTCTCACCACG
GGATCCCCTCGGGCGTGAACGCGATCTCGAACGTCTTCTATCGAAGCCACGGTTTCCCCTTGAACGCTCGTGCTCTCGTTGCTGCTGCGTTGCTTGCAGA
TTGCGCTGGTGCTGCCGCCGTGGTGGGGACCTATTGTGCTCCATTCCTTCCCCTTCATCACCTTTGTCCGTGGTGACCGTGTCAGCGGCGCTACTTCCAA
TTTCACCTTCTTCCTGGCCCGTACCGCTTTCTAAAGCCTTCTGGCCACGCGTCGTCGTCGGCACGGCAGTTCGCTTCAGCGCGGCAGTGTCTGCATCCCC
CCGTATGGAGTCAATACCACCGACTTTCGTTTCTGCAACTGTGGTTTCATGGTCCTTTATCACCCGTTCATCCAGCGGATTCGCGCTCGATGGCTGCGAC
TTGTCTCCCTCAGGGGCATCTAGCACTTTGATGGCCCCAGCACCGGGTTCCTCACCCCCCGAACCATATTGATGACCATGGAATGATTTCGATCTCGATC
TTGATCTACGCTCCACTGAAGGACTTGGCCGATTGTTCCCACTCATGGAAGGGCCGTAGCGACCCTCTTTCCCAGACCATTGCGATGGGGCACCTCGACC
ATACCTCGAACTTCGATAATCACCTTGTGGT