Description :
Non Conding Region
Location :
Scaffold_1:76743- 80001
Sequence
3258 bases(100 bases per row)
GCCGCGCATGACCAGCAACACAACCGAAGTGAAGCCATTTGTGGATACTAACCAATCAGATCAGCTTCACCAGTTGATTTTGACCAATCAGCGTTGGTAT
CATCGTGCGATCTTTCGAACAATAGAAAAAGAGCTTTTCGAAGACCCACTAAATCGAAGAAGCAACCACTCATGAAGGTCATGGCGTGCCGTCGCATGTG
GTTGCTGCTGGTGCTGTTGCATATCCACCTCGCGTGCGTCGTCTCCAACGTCACAACCACGACCACGCTCACTGCCGATGTAACTTGCCGTCATGACGAC
TGGACAGCCCAGCCGTTCACCCCACCGCTGCGCGCGATGGATCCTGTCGTCGTCAACTTTCAAGCCACGAGCGTTGCTGCCCCATCCGTCCGTCTGCTCA
TCGGCGTCAAGTCGAGCGTGATCCACGGTGTCGCAGCGCGTCGTGCGATCCGCTCGACGTGGGCGAACCGGTCGTCTCTCCCTACAGGCGTGCGTGTCGT
GTTTCTCGGGTGTGTTCCCGATCTCTCCCCATTCAACGACAGCGAAGTGGATCGGATTCGTGATGCAATCATTGCTGAGCAAATACAGCACGACGGCGAC
CTACTCATTGACGAACTCGCGTCTTGTCGCGACGCGTACGACGATCTCGTCAACAAAGTGCTCGCGTTCTTCCAATGGAGTGCAGGCGAAAGCTCCACTG
GCGAGACCACGACCAAGTCATACGTGATGGTCGCAGACGACGATATCTACGTGCGTGTGGACCGACTTCTCTCGCTGCTCACGGATCCGCAGATTCCCGG
GAGTCGTTTCTACGGGGGCCAAGTCTGGACCCAGCAGTTCCGTCGCGTGATGGAGCCACGCCGAGAGCTGCCCGGCTCACGATACTATCTCTCACGCGAC
CACTACTCCCTGGACGTGCTTCCGCCATTCGCCAACGGTCCGCACTATATACTTTCGACGGATGTTGCTCATTTCGTCGGCCAGCATCGTGATATCTTTC
GTGGCGTCGGTGGGGATCCGTTCAGTAGCCACAGCGTCGGTACACTGGACGATGTGTCGGTCGCACTGTGGCTGCTGGCCATGCAGATCCACCCGCACCA
CTTTGACCAGTTCATCGGCCTGCGGGATACCATGTGCGCCAATGACGTGGTCTCGTTCGCCGACCTCACGCCCCACGCGCTCGCTCGCATGCACGCCAAC
GTGCAGCAGCACCGCACTGTCTGCGAGGGCTTCTCGTTCGCGACGTGGCTCATCCGTCTTTTCCCACCACGCACGGAGCAGGACATCCAAGACGACCCGC
GTCGTCTTGCGGTCTGGAACACTTTAGAGATGACCTGCCAAGGCGAGCGGCTGTCACACACTGACGACCTGGAGGTGTTTATCGTGGTGCGAAGCAAAAA
CGAACCGTCGCGCGAGCCGGTCGAACTTAAGTTTGTGCCCGCCAGAGACCCCTTCTTCGTCTTCTGCTGGGTGCTGACCGAACGCATTGCCGAGGGCCTC
GGTGTCTTAGCTGGTCAGCCCGTCTTTATCTGCGAGCAAGTGCGCGCGACGTTGCGGCAGCTCATGATGGACAACGTCGTCCAGTACCCGTGGAAAAGGC
CGTTGGGCGAACTGCTGGTCCACAACTTGGAGAGCGACGTGGTGACGCCGCAGCTCAAGGTCGTGATGGCAGCAAACACGGCGTACGCTCGCGTCGTGGT
GGAGAACTTGCTGGCACAGGCGTACGACAGCGTCGAGTTGCAGGTGTTTGACGAGGCAACGTATGGGGAGGCGGACCGAGACCCGGATATCGTCTTCATC
ACGACGGCTGAGGCGTCCAATGACACTTGGGCCAAAGCACTTGTGGACACGTTTGTTCACAAGTACAAGCGAAGCAGGCTCGTGCTTCTGCACCCACGCG
ACGTGCCTGCTGACGAGAACGAGCGAGTGCTTGCGTTAGCGTCAACACGTGCCGGCGTGACGATTCGCCCGTCGCTGTATCTTCCGCTGGCGTCCATCGC
CTTCGGGAGCAGCGCGAAACACTCTCCCGTGGATCTTCTGTGGTCTTTCGACACCAACGAGCGTTTGTCGCGAGCGCCCCCGTCAGCCAAGCCAACGTTT
CGAGTGCGGCAGTTTTGCGTCGACGACTATGTGCCCCACCAGTGCGATCACCCGCACCGCCAGTACTTTTCCCAATTGCTGAACTCGCTCGACAACGTCG
ACATTGCTGGCGCGTGCCCACGCCATGTGTCGCGATCTCGGGGTGTGGTTGGCAACCACATGCTGAACGAGAGTATCACCACGACCAGCACGTACGCTCT
TGACCGCAAAGTCGATCGTTTTGCCAACTACAAGTTTGCGATCGCATTTGAAGACGCCATGAATGCCCCAGGGCACGTGGGCGATGGCATCGTTGCTGCG
TTTCTCGCTGGAAGCGTCCCTATCTACTATGGCCACTCGAAGACGATTTCGAGACTCTTCAACGCCAATGCGTTCATCGACTGTGGTGCGTTCGTCTCTC
TACGAGTGTGCGCCAAGCACGTGCTCGCGGTCCATGCGTCTCCTTCGTTGTACGAGGCGATGCGGCGAGAGGCGTCGGTATTGAATATGACGGCGTTTTA
TGAGGCGTTCTCGTGGCATCCGGATGTTGCGGAAATGGTCCAGAAGGCGCGAACGCGAAGCAAGGCGGAGGAGCTCCTCACGCTCAGCGAACAGTTCAAG
CAGCAGCTAGATAACGCCAAGAACTAGTAGCGGTGAAAGTTCTCGAAATGTTCCAGGACGACCTTGGACGCTCAGTTCTCAGCGTTGCCGCGATCAGGAT
CACCTTGCAAACCACGCTCGTATCTAAGTCACTATGGAAACGCCGGAGTAGAGATAGGCTACGATTGATTTCGCGAGACTTCCGTGGCAATGGGTTCGAC
AAGAGATACCCTTTTTAAGGCGATCATGTGCAGTCATATCATCTTTATTCCCAGCGTACGCTTCCATTTTATCTAGTTTTCATTCTTCCATTCGTTCTCT
TCACCTCCATGAGCGTACTCTCGTGGGCGTTCGTCGTGAGTGTCGTGTGGCAGGCGCGTTTGCAGCTCTCTGCTGCCGCGACTACCGATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCGTGGCTGCGAATCTGGATCCGCTCGCAACCGCATCGTTCGATCGCAACAGTCTGACGAGC
GTACTGACCGACGAATTAATTCACGAAGATGAAGACTTGATGACATGGTCCTCGCGCA