Description :
Non Conding Region
Location :
Scaffold_1:76692- 76965
Sequence
273 bases(100 bases per row)
TTGGTCGTCGGGAGCTTCTTGGTGACTGGATGGATACGGCCAACGTGCGGTGCCGCCAGACGATTCAACCCATCCCCCcGCACTGTCACTAACGGTCGAC
GCTTCACCCAAAGTCACTCAAGAGAGGCATTGTATCGTGCGGTGTGCTTCCTGGTAGTCATGCCGGAAACACCACTCAAGGGACAAGTGCACGGTATTTA
TTCTGTTAAGTACGAGATTTGATGTGTGGCACCGGGGGgACCGCGCACTTTGCGAAGAGCTACGAAGCCAAGA