Description :
Non Conding Region
Location :
Scaffold_1:76621- 77621
Sequence
1000 bases(100 bases per row)
ATATGTATACTGCAATAGCCAATCCGATCCCCTCAAATTTGGATTAGCCAATAGCGTCGCTATTCGTGATTTGGCGGCGATCATTCGGAAATTTGGACCA
AAACCACATTAACTATTACAGTACATACAAAGTACTATTAACGTTAATAGTATTTGCAACTACTATACCTTTTCCTGATCAAAGTGCCACTTTATTCCAA
TCAATGTGGCGATAAAAAATATAAAACGTTTGAAACGCAAAGGATGGTTACAAAGAAACTGCACATTTCCATTACAATGTGGTTTTATTCCAATCAATGT
GGTGCAAAGTCACATTCCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGAAGGAATTGAACTCCCTGCTCTCAAACAGCAGGTTCGTGCGCGAGGCAAGAAATCTCTTGATGTGGGCCTTCAGAACG
CTAAAACAACTTTCAATAGGGTTCAACATTGGAGAGTACGGCCCAAGGCGCAGAAGTACCAAGTCCTCGTGCGGCTGAACTCGCTGCTCGGTTTGTGAGT
GTGCAGGTGCGTTGTCGAGCACAATTACCACCTTCTTGCCTTGAAAGTTGGCACCTTTCCTCGCGCTTAATCTGACCACTTTGATTGGAAGAAAAACCAC
ATTGATCCGAAATTATCCACTTTGGAAACCTTGTTAAAATATATATTTTTTATCCAAACCACTTTGATTGGAATAAAGTGGCACTTTGATCGGGAAAAGG
TGTAGTATTCTATAGACTTGTCAGTATCTAGTTATGCGGTGCTGTCGAGTACTAATAGTATGCAGTAACGTGAGAACTACTCTACTTTCCATTCGTTGCA
TTGATAGCGCTGACACTAACTAGTATGTTGTAGCATAGCATGCTATACTGTATGTACAGTACAGTAGTAGTACTGTAGAACATGCACGCATATAATATAC