Description :
Non Conding Region
Location :
scaffold_1:76585- 79283
Sequence
2698 bases(100 bases per row)
GTTGCCGATGCTGTTCTTTCTCGCACTGGCAGAAGCAAACAAGAAAGACCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTGG
TACTTCCACTAAAAAAATGATCAATTCAAATTTGATTCATCAGTGACGGTTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGTAACCGCGGCATAAT
CCGACGCATAATCATGTCGGCAGACCTCCGATCCTCCACGTTGCTGTTTAAATGGCCCGGAAAGTCGGAAAGTGGGCAATTCGCGCTCCACTGGAGGCCA
AGTTGCCCGACATTTGACTTTCCGAGCCAAACAAACAGCAGCCAAAATAATATTTGGGCAGTGTCACGATGCACTCATCACCTAGCCCTAATGGATATTC
GCGCGCTCTTTCTTATCGTGCTCTCGCCTCTCCATCCGTGAGACCCGAACGAACGTATTGTAGTTCCAGCTCCAGGTCCTCATATTCACATCGTAGCTCA
CGTTTTCCCGATTCGAGCGCGCCATTTAGACGCAGCAGTTCCGATACACGAGCTTGAATTGTCTCCAGCTGGCGCAGTAGGTCTTCATTAAGCGTTTTCG
CTTCACGAAGTTCTGTTTGCAGCCGGGTTTCCTTCTCCCTGGGCCCTGACGCCTTTGTCGCCGCCTCAAGCTGACCCATGAGTAAGCGCTCACGAGTTTC
CAGCGCGTCTACCCGGCTCTTTAGCCGGCCAACCTCGCTTTGATTGCCACGTTGCTGCTTAAGCTCAAGTAGCGGTAGTTGAGTCTGCTTGTCTTCCAAA
TCTTTCTCCAGTTGCTTTCGGCGCTGCTGTTCGACCAATATCTCGTCTTCCAATGAATCTAAACGCTTCCGGAAAGCCTCCCACTTCGTGTTTCGCGCGG
TCCAGTCACGCTCTTTCACTTGCCCGATCGCATTCTCGAGAATTTGGACTTTATCGCTTGACTTTTCACGAACTGTAGATAGCTCCTGGGCCTTTTTCTC
CATCTCCAGCTCAAGTCGCTGATTTTTCAGGAGTGTTTGTTGTTGCGTCTCCGTTACTAGGTCGTACTGCACAAGGAATTGCTGGTAGGTCGTCTTGATC
TGCATCAACTGATGCTGGAGCTCGCCTACAATTGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCT
CGTTAATTCTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATC
GACTACAGCCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTTCTCAAGTTGATCTATCCGGTCGTGGGGGATATCT
GAATCGCAACCGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTG
CTGGTAGTTCATACATCGCTAAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTG
CTGATCAGCAAATTCACGAAGCACGCTCTTCTCCAGAGTTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCCACGTCTCTAGGTACAAGACT
CGATACTTATGAATCTGTTCCGAGTCGTGCAACTCGCCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGGTGGGGTTTCCTTACGCAGTGAGTGATCG
CTCCCTAACAGCCATTCATAGCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAA
TGCATTTGTGTTGGAGAATGCAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCG
AATGGCTATACCTGCTCTAAGAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCCGGGGGTGGACTG
GTAGTCTGTCGACCGCTACATAGTGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGG
AGAAAGAAGATGTTTTGAAGCAGACAGCGATCACCAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCCGAGAGTACGACAAGTCTGACATCC
AGAGGCGATACGTGAATGTCGGCTATTGTTTGATGAACTTTCGTGTTCACAAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGGGTGCTGCTCAGTCCAT
ACATTGGTAAGGTCTGTCCGTGCAGCTCTCTCAAGTCTAACTGCACGCGTTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATC
CGCAGAGGTGACAAGATGCCCTTCGGGGAATAATGGGTTAAGTGTCAAATTTTACTATCAGATGAAATATAAGTGGGCCAATTATCACCAATTGTTTTTA
CTTTCACGAATTTCCCAATTCGAATTTCCGCGAAGAACTTTGCGGAACCACAGCCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGA