Description :
Non Conding Region
Location :
Scaffold_1:76470- 76684
Sequence
214 bases(100 bases per row)
CTTGCTGCGTGGCACAATTACAATAATTCGTTCTAGAAGGTTTAGAGTATGTTTTTGTATTGAACTTGAGGTTTCATCATGATTCGCAGGTTTAATAAAA
ATGGCAGGGACCTTCTGAAGTTGAAGtaggagtgatggtcaaaTCATTGCCGCGCGCGGACTGGCAGCCTCAGTGCGGAATTCGCCGCGTGGAGAGCTAA
CGACCAAacggaga