Description :
Non Conding Region
Location :
Scaffold_1:76351- 84331
Sequence
7980 bases(100 bases per row)
GCTATGATGATCGGGGGGACACAAGTTTGACTCAGATCCCGTCAGAAAGTCAAGGTTACTGTATATATTCGTTTAAGTGCGATCAGAACGAGGTCGGGAA
CTTGACTGGCAACAGCTCATCACGCATGGCGTCCCAGCGCGCGATATCCTTGCTGGCGTCTTGTGGCGGAGTTTCCAGTTGGCACACGGCACCGAGAGAG
CAGATGCCGCTGGTGTCACGAGTCCCGAAGAAGCCGCAGACGTAGCCCTGTTCGCTACTGAGAGAAGTTATCGACCCAGAGTCTGCACTGCCAAACCACT
GGGTAGTGCGCAGCGTCGTCGTAAGGCGAAGTCCGACTAGCGCTGAAGAGGAGTGACAGACGTCTACGCGTTGGATCCGCTCACCTGCAATTAGTTCAAG
CAGGTGCTCGTTCGGGCCGAGGGCACTCTCGCGATCGCGCAAATAGCGATTGTACTGCTCGTCGGAAACGATGGAGATAGCTCGCAAGTGACTGGAACAC
GTGATGGCAACCGCTTGAAGCTGCATATGGCTGTAGAAGAAGGGCTTCCCGTCGATATCGGCCTCTCTGATAGTTACAGGCGACGTCTTGGATTGTTGTT
TCGAGAGATCCACTTGAATGGGGTCCATGCGTGACGATCGTGAAAGCAGATCGAACCGGCAGCCCAATTGATTACAGCGCTGCCCAACGTGTGACCCGTA
GAAACTGGAGACGTACCATCCTTGTGGGGCTGCTATTTCTTCCACGTTGTAGTGATCATGGTCTTGCCACTTTCCTGTGCCGCCAAACCACTGGGACGAC
CTCAGATTCGTCCATATCTTCAGCGAAACCAGAGTATTTGCTGACGTTCGCACGTGAAGACGCTCGATGAACTCGTGCTTCATCAATACGAAGGTGTGTT
GCACTCCGCGGGAACACACGAGTGAGCTGTCGGGTATAGGTGCCAAATCACACCGAAAAACACATCCCACCGCGATGATGGCATCTGCTGCATCAATCAT
CACCACTCCCAAGTCGTAGACCTCGCTCTGCCACCTGCGACCAAAATCAACTTGTCCAACAGATTCGCGGCCAATTGCTCTCGACAAAGTCGACTTCTGA
GGCGTCTTACCGGAGGTTAGTGTCATTGCTGCCGTTTCAGCAAGTTCTGTGGAGAGCTTCAAATTAAAACTGAGCACACCTGAAGCTTGGTTGTGGTCGT
GCCACCTGTGACAGATATTAACATGGGTTGTTCGTAGCCTTGTTAGATTTGGACTAGAGGGTTGCACTCTACGAGAGTCGTGCATCCTTCAGGTGATTGT
TGTTGACGCCGTTGCAAATATTTCTGTTTCCTCCACCACTTTTGGATAGTGGTGGCATATGCGTTGTTCCACATGGTCGTCAAGATTTCCTGACGTCGTT
GGTCTTCCAGCCGAACTTTCAGCTCGTAGAATCGTGCGCGTGCCTGCTTCGCTCGATATGCATTTTGAAGCAATACAGCAGCTGCTGTTTTCCGCTTCAG
AGTCCGATCCACACGCACGGCAAAACATCGCACAAATCTTGAGCGTCGAAGAAACTTGAGCACCACTTGGCGGGCTTTTGCTAGTCGCTCGCGTTTTGTA
TTTGCACACCGTATGCGGGTTATCGTTCGTCGCGTCCAGACCTGAATGGCAATTATCGCGTGATAGCGTGCAAGACGATGGCACCAAGCTACAAAATCGC
GCTTCTTCACGATATAATGCTTAAGTGCTCGCGTTATTACGCGGGCTGCACTTTGGTACCTCATCCAGGCATCAAAGCGCTCTCGAAAAATGTGGGAGTG
ATAACATCGCTGGACGTGATGAGCTGCTGTGTGGTACGCATAAAATCGCTTCCTTCGTTTGAACATCTTTCTGCAGTAAAATCCTCGCCAACCTGCTTGG
ATTGAAGTCGCGGCTTCGTGCAGGTGGCGAACTGCCGCAGTTCGTTTACCTTTCACACTACGAACCCAGCTTTGAATGGTGACAGCAGCAGCGATGGTTT
CGTCCTCGCGTTGATGTACAGTGTCCACCATCCAGCGACTCCATAAGCAAAAGACTAATTTTTCCAGTTTCTTGCGAGATTTCTGGAGAACCCACAATGC
GCATTTGCTGTCCACATGATAATAAGTGAGCTTCTGATCAATCGGATGCACCATGAGATGAATAGGAAACCTACAGACGGCAAAATCTGCGAATCTGTTC
ATCGCACTGCATCCACGTCACTTGCTGAAGCCAACGAGAAAACCGGCGGTGCTTAGCTTGATAGCAGTGTTTGGAAAAGATAATCTGATGGAAGGCACGA
CGAGCAAGGTCAGCTCTGCAGTAAAGCATGAATGTCAGTATCCGGGATTCGTACATAGAGTTTTTCAACTGCGAAGTTCTGTCGTATTGTCACAGAACGA
GCTACTTCTTCCATGCAGTGATCGCGAACCCAGTCGCGAATGCTTTGTGGACAGACCTTCTGATCTGTAGGAGCAGAACACATCAAAATGTCAACGTCAT
AGCTGATGTACATTTTGGCATGGCACGTACAACTGACGGGGTTTGGTCCGATTGGGATGCATTCTACCCGACTTGCTTGCTTGATACTCAGCTGAGAAGT
ATCATATCCCTTATCATGGAGTTTGCTTGTGTACTTTGGGCGAGCGCGAGTAGATGAAAAAGCTGTCGAAGCCTGTGTTGAGGAGGAAGATGCCAATCTT
TTGAAAGTAATAACTTCTGGCAGCGTTTGGGCAACTGAGAATGTTCGACTATGATGCCATGCATTGCGGGCAAGCATCTTGCACAGCGGCATTGTAGCTC
TCCTACCACTGGAAGATCGTTTTGGAGAATGAAAATCGGCGCACTCGTTTTGACGACGAAGCGTGGCAAGCGCCATTTCCAGCTCCATAACTTGCTCGTA
CGTCAGGCGCACTTCTCGCAGAAAACTAGCGCTTTCAAGTGTGCTCGCCACGTTCGGCTGTGCAAGCAAGAGGAGGGCATCCTCCACGGCCAAAGACTTT
AAACGGAATTTGTCTTCCCACACTGAAAGTACATGCCCGCGAAAGCTGTCAGACGAAGTTTCCAGATTTGATCTCTTATTGGGATGCGAGATGGCAGGCT
GTTTAGGCGCGGAGGAGACTATCTGTAGTGGTACCACAGATCGATATCGCTTTCTTTTGTTTTCAAAAGCCTGGGGCCTTTTAATGTCGAGCACTTTGCT
ATGTGGTTGCCGGGACTCCAGCAAGCATCTTGCGTTGCATAAACTTCTTTGTTCTGGTAAAACTTCGTTCAAAATGCCTGCCACACTCCACTCCGCTCCA
GTAACAGCAGCAAGACGACGGACAAGGGGATCTAAGCTCATTGCCAGTTATATAGTCAGAACGTGAACCTTGAGCTGTTGTTTGCACGGAGATTACCTGT
TCTTTCGGGCCCTATGCTACCTCCGGCCGCTTCACTACTCACATCTCGTCCTTGCATCGGCACTAAAACCATCGCTCTCCAGCTAATGACATGAAGATGC
TAATTTTGGGTTCACTCTTCACTCGAGGTCGGATCGTATGTTGAGCTCCTTGGCCTCCATAAAACCGAAGAGTTCCTGGCATTCGTCCTCGCTCAAATAC
ACTCGCAGCATGCGAAGTCCATCCATGTACAGCGCTTTGCTCCAGGCACAAGCTGCAATTCCACGATACAATATCTTTTTCGCGGCATCCACTTTTCCTA
GTGCTACTTCAAAGCGCATGTACAGACGCCAGCAGAGTGCGTTGCCTTTTGTCCGAATATGATTAACCATACTTTCAAACATTTGCCTGATACGTCCAAC
CGCGGTTGCATTCATCCCCCATCGATGAAAGAGGCAGCATAATTGGCGAGAAGGCTTGTTGGAGCTCGACTGCGCCGTATCAGACAAATCCTTGATAGTC
GCAGCTCGTTCAACGCGGGAAATTTCACAGAGTAGAGCGAACAACCACTCTACCAATTCCGGTGAATCGTAGTATCGTTGCCAGCGCTTCTCAACCCGAA
GAAAGTAGTTACGAAGCACCTGAGAGATAGTGTTGCCAGTCTCGGCATCGACAAAGAGCCGAAGAAATAGCGCGTTGTTCGGAAACTTTTCAACCGCTTG
ACTGACTGACGAGCGCCACGCACGAGGAGCAACCACGGGAAAGAAACCCGAAGCCTGATGCTGCTGCATGAATTCGAGGAAGCAAGTCCACAGCCACGCT
TGATGTGAGCAGCTATGGTGTTTGGTATTAACCAACGCTTGGCGGTATTCGTGACAGGCTGCTTCTAACCCTCGGAATGCATAAACAACGAGGGCCAAGT
TGTGTACGCAGTACCCAGCCCAGCAGGTTGTCCGGGATTGAGATCTGTCACTTGTTGTATGGCCCTCGCAACCACGTGGAGTAACTTGAACGCATTGCCG
AATGGCAATGCCAAGCTCGGTGCGATATCTAGCGATCAGGCTTGCTCCGATCGATCGATCCGACATCAATTGCTCCTCCAAGAAAGCACGAGTCTGCTTC
CGATGTTTTTTTGTAATTGCATCCAGTGTTTCCTTCTCTTCGCAATCTGGTCGCCACACGTCACGTAGCGTGTGCAGACACCGTAATATACGAAGGCGCT
CTTGATCACGAGTGAGTGCTGCACTTTGGTTCATTTCGTCAGTGGACGGCCACATCTCTAGCCGCGCGCGAAGAAAGACAAAGCGATGAAAATGTCTAGC
CATGGCGGCGTTGCTTGACAGCGGGGTACCGATTGCGGTGAGAGTACTCTCGCAGATCCGTCGTACCTGGCGTTCATTTCCGAGTTTAAGCTCCAACTTG
GCGTAGGCATACAGCACATCATAATCTGTGTCGACGTTAGACGTTTTCTGAGCCAAGCGTTGGCTCAAACGCCGAGCATACACTAAATTTGCTTCTTCAC
CACCAACGGTACGTATGACTTCGGCTTCAAAGCTAATCCACAGGCATTTTAGCATGCTTGCGAGATCTTTATCAGCGTTGTAAAAGACACCCAACGCCCT
CATAAAGGTTCTTCGTACAAATGACACCTTGTTGGGATCACGGAGCACACGTTGCTCCACTGCGACGTCGTCGAGTAGGGCACTCTGGAGCAAACCCTTT
CGGTCGTGAGGTTTAAGAAACAGCGTTTGTTTCTTAGAGTAAAATGCTTGGGGGTCAAGTACAGACAAAATTGGAGCTACAAGCAGCTCGAAATCTGTAG
CATCGTCTGCATACATAGACTGACAAACTTGAAGATTATTTTCCCATGCGTACTCACCACACCACTTCACGCCACACATATGCAGAAGCTCAGCAATTAG
CCGCCATTGATTCGCAGCCAAAACAGGGAACAGAAATGGTTGAATTTCTTCAGTCAGTATTGCGCGGTCCGGCTGCAGCTCGATAAGCTCGTGGTGAAGA
GGGTTGCTTGAGCGCAGAGGAACCCATTGTAACGCTGTCTGCACTTCCTCGTGCATAAGCCATTTCACAAAGCGGTCGCCTTCTTCGATCATATCGTAAT
TTGCGCGTTGGTCTTCCACCTCCGATTCTGTATCTACAAGCATCGCACGCTTCATCTTTTCCTTTTCAAGCAATTGATCTTGCCGGGTTCGCGCGGTTTC
CGTACCGCGCAGCTCACCTAGGATGCGCTCGTATTCTTTAGTATCATCAGCATTATCGACGCTAATGCGGTACCCATGTAGGTTGCTGTAGATGAGTTTA
CCACCAGTTCTGGATTCAATCTCTGAATCGTCACTTGCATCAAAATCGGCTAATCTTGACCCCAAGTCGCTGCTTCTCTCACCAAAAATGTCAGACTTTG
TACCACCTTTTACACGAGATTTGCGTTTGTACTTCGCTGAAGCACACAAAAGACTCTGCTTGTGCTCTTTGGTACGCAGAATTTCAGGGGGGTTCACTTG
GTCGAGCGTAGTAACGCAAGTTGTCTGGATGTACTCCTCAAACTCAGAGGCAGAAAAATGGGGGGGATCATCTTCATAAGTGCAATCAACTGACGTGAAG
TTCTTCCAGCCCTCCCCTCCAAATCCCACCGTGCTTTCGTCATTCCACCGCACGGCAAACTTCTGTAGCAGATCCAAATGGGCTCCAGTGCTGCCACTCC
TTGTACTTCCAGCACAGTCGTTTATGCTAAAATCAATTAGCGCTTGTATTTGGGCAATTGAGCGTTCAACAAAACCCGCCTTTTTCTCAAAGACGCACAT
GAGAAAGTGAATATCAAGTAGTAATAACGACAACTTCTCCAGTGATGGGTCACGAGATTCAATCCCAGTCATCCCCTTCAAGTCTGTGGCTGACAATGGT
GACTTCGCCGGCGCTGTTGCCCCATTTGCAACATTTTCGTGTTCTGCTCTCATAACAGATAGTATACGTGCGTACAGATCGCGTATTGATTGCATCGAGA
AACTTCCAAAGTGCTGCTGACGACTTTGAAGTAGTTTGATCCACAGCTCGCTGTTTGTAAGATCTTCAGTAAGAAGACTCTCTAACTGCAGATGAAAGGA
GTCATGGTCATCACTCGCCTGAGATTGTAACGACATGTTCAGCTTCACGCGATGCAATTCACGCGACTGGGGATTACTAGCAAGCGCTTTTGCCAAAATT
GCTGCTTGCTTGTCCTCCACACTTGCTTTCATGACCAAATTCATTTTCTTTGTCTTGGTGTGAAAAAGACGCATCGTATGCTCTTGAAATACCATCAGAT
CGAGCCAAGCGTCGATATCCTGCGGGCTTACAGCTACAGCAGCATTGAGTAACTTATTACGTTGGACAAGATACTGTTCCACGCTCTGTCCATCAGATAG
CAGAATCCCTTTATCATCATCACTGACAGCTAAGCTGTAATTGCGTCCTTCACCCATGACACCACCCTCGAGCCAACTGACATCAACAACCGGGTCAAGA
GGGATAAAATTCATCTCGGGTGGGCGAGAAAAGACACGGCTGCCAGCTTGATTGTCTTGGCTGTGACCTAAGTCCTCGATAGCTGCCGCGCGAGCCGACC
GTCTCTCCGAGTAGGCAATATAAAGACGCTTCTGCCGAGCGTCTTTCTCCGCTTTTCGGGCCTCCAGCGAGAAATACCGATTGGAGTCTTTCCTCTCTGC
CTGCCTTTTAGGAGTCGCGTATGTTGGCTGTTTATGAGATATCCAATTACCCGTCAGGAAATTCCGTCGTGTTGCCAACTCGTAGAGCGGCCGATCATGG
ACGTACGTCGACCCAAAGAACTGATTGTTGCGGTCACCCACGCAGTCGAACTCAAAAATCTTGCCCTCTCCGTCAGCAGCTACACCCTCGCGGAGGGCAA
TTTCTTTAGTTGTATCAGTAATAATCCGCTTCCCTTCCTTGTGTCTGGGCGACTGGGATCGAGCCCGGGAGCGTGGGTTGCTTCGGCTACGCCGCCGACG
TCGTGGAGAGCGATGACTGGAGTGGTAGTCCCTATCATCATCACTGCTATCTGATCGACTCCTGGACCTTTTTCTTTTCTTGTCCTTGCTCTTTTTCTTG
TGTTTGGAGAGGTGGCGACTCTTACGCGACGTTGCGGCCAGTGACTTCTGCTTCTCCTCCCTGTCCTTCTTCTTCTCCTTATGGCGATGTTTACTGTGTC
GATGCTTGTAAACTTGCAGCACGGATCCTGGTGACTCAGTTGCGTGGGCTTTCTCGTCACCAGTGCCACTGGAAAAGCTCTTGCCACTGCTCAGCCAGTC
TAATGAATAAAACAGGGAAAACAGTGTCAATTCCAATACTGCATCTACCAGCATCTACACAACGCACCGCCATCTTGCTGACGACTACGGCCGACTTCTA
CGCCTGCCCGGACGCTCTGCGAGGAGCAGTCTGCCGCCGCCTTCCGTCCAGCTGCAAACATGCTGAATAATCAATTGGTCCAAACTGTGATAGGTTCAAC
TGGATTGGTCCACATTGTGATTCCTCAAAATATAGTCCGAAATACGTCGCGCACGCATTCACGTGCGTCACAGTGAATTA