Description :
Non Conding Region
Location :
Scaffold_1:75852- 76627
Sequence
775 bases(100 bases per row)
TGGATGCAGTCAATATGTCCTTCACGGTACTTTTCCTATAACTTGTATCCTCTCTATAGTTATAAATTAATTTTACTGTGTATGCAATATCAGCATTCCA
TTAAGGCTGGCAGCAGGGGCAAGCACAGGAGAAGACGTACGGGGCCGGTCGCCATCACATCCAAGGCGGCATCATTGAGAGATGACTGTGCGGAAAGTGC
ACTGTGGGCGAAATTCTAGTGTGCAGGTTCGGATACTACTGTGGAAGATGTCGACAAGCCCTTTTGATATATTTCACAACTCGATCATTCGGTCCAGCGC
CAGTGGCGCTGCGCCACCACGTGGAGAGAAGTGTTGCGCATGAGGCCCCAGACTGGGACGCTGCATGCGTTATGACGACAATAACGGCAAGGATCACACA
TTGATGTCTTCCCAACTGGAATTCTACCGAGGGGTCGTTATGGCAGATTGGCACAAGAGCCGAGCTTTCGTGACGCTCGGTAGGAGTTGTAAGGTGCCGG
TGGCCAACGGCGTCATGGATTGCAGACACTTCAATATTCCACACTGATCTCCTCTATTGGCCCTTGGGGAATTACCAGTACGATCGCTGAAAATACTCTC
TCATGATAGTTTATTTTCAGGGTTCATGAAACCTCGTTGCCACACCTCAATGATCGTTACCACTTTGTAGTATCACGCTTCATTCTCCTTCCAGCGCCCG
GGACCTCTAGACTGCGGATTGTGAATTCGATCTATTTGGCGTGGAGAGTGAACTGTTCTCAGCTCAGCAAAACTA