Description :
Non Conding Region
Location :
scaffold_1:75741- 84681
Sequence
8940 bases(100 bases per row)
GCAGATAGATACTGAAAATGGTACGTAtctaccgtacttcacaaaaaaaacacctgacctacttttgaaaggtgaTTTTGTTAATANNNNNNNNNNAGAG
GGTCGAATCGAATCCCTCATCCCGAAGGACATCATAACAATTTTGCGATACATGAAAATAGAACACCAGCGAATAGGGATCTTCAACTTCACACTCCAGC
TCGCAGGGAACGAGGCCAGTTGGCTCGATGTACTTTCCGCCGTCGTGATTGATGATTCCGTACTGCGAGTGTTGAACGAGTTTTCTCCGGTGCGCCTTCC
GGGACGGCATCAACAATCATGCACTTCACCTTAGTCCCAGTACGAGTAGAGGTATGACTGGTGAGCATAGCATGAGCAGATGACTCATCTAGGTCTATTG
CAGCCCGTGTCCTAACTTGTGGCTTGCTGGGGTCATGGGTTGATGCTTCGTGCTCGGCGGCACACTCTCTTCCATTCATGCTAGCATCGGAAGTGTCAGA
CGATCTACGAGGATGAGGCCGTAAAGATGGCGGCTTAGCCCGATTAAACTTGCGGAAACGGTGTTGCACAAAGCACGGCTTTTCTTCCGAGTCGAAATGT
ATTTCCCGAAGGTTCTCCGGTCGATTCAAAAAGCCCGGCAGGACAACCCACACTGTAAAAGTATACAGTACGTCCCCTGGACTTCACTTGACCGTGCACG
TGCGTAGGAGTAATCAGAACAGGTCTGGCTCCTCGTTGCACGAACCAGTCGTAGATCGTTTGATCTGTAGCGTCTTTCTGGAGACGGGTCAAACCCACAA
AGTACAGTTTGCCGTACGTTGAATACTTACAAATCACTGatgccacataccgtaagCCGCAGGTTGCCCGGCCTTTTCAAGGCATCATCCGACGTGCAGA
CGGACGAAATCACACGACGCGCATATGCTTGAAAGTTGTGGTGATGAACGAGACACTCTCTCCATACCGCAGGTTGACTTACCGAAGCAAGAGAACTTAG
GACTGCGTCCTACCTATGCTCGGTGGTGAGACTAGCAGCCGGAATACACATGTTTGTACGCGTTTTTGCAGCTACTGGCGTAGGGACCGCGGCAAGTGCA
GCAAATCGACGATCTTGATTCGTTGAACTATNNNNNNNNNNTGCTGGCTCAACtcctgggtggccgagcgcctctAAGCGCCACCCCTGCGCTAACGCTT
CCACTTTCACTTCCGCCGATACCCGGTAAGTCTTAAGCAAGACCACATAAAACCGTGTGGGTGTGGATACTTCTCAGAAGCTaaggcgtatacgcaagcc
ttgattggccacgaccttaagagGTTTAATAATCCGTGGACGgggcttcgtcttaaagacaacaGGAACTGCATGTGGGACGGTGTCAAGCATTTAATTA
ACCCATGTCTCCGACCTCGATGTTTTCAGCatatcttcttcctcttccgtctgcatttTTTCTACATGTCTagactttcagccatcgcatcgcgaatgtg
tcgttcgatactcagtctggtagacagaaatTTCCGACATTGTTACGCACAGTgatggggctgacatcagctagccgctcagCTACTCCTAactcaccaa
gccctgagccttgggatggcggcgtcagcgggaccaAAGgataacaagcccgttcacggcGATCggcatgtagccggtagatgaatgcactgataTCAGT
GAGTCTTGTGAAATGAACACAAAAGAAAGTGGCGAACGTATTTTACTCCAAGTGAAGTACAATGAATTTAACAGTATAACGTTGTTTCGTCTTGGATTTT
ACTCCAAGTGAAGTACAATGAATTTAACAGTATAACGTTGTTTCGTCTTAGACGTGGCGAACGTATTTTACTCCAAGTGAAGTACAATGAATTTAACAGT
ATAACGTTGTTNNNNNNNNNNATTCAAATCAACCCTAACTTCTACTCGGGATAGCAAGATCGTAACCACTCCAAGTACCGGCAGCATCTTTCTTTATCCA
TCCAGTGCTTCGGATGGAAAGTAATCTTATTTGATCCATCCCAGTTAGCGAAACGTCGGATAATGTTCCATTACGGACACCGGTCATTATAATGAAAGGA
GCCAGCAGGCGTGATNNNNNNNNNNGAAAAGTTCAAGACTTGTCTCGATTTGAGAGTCGTCAGGCACCCAGCGTGGCGCAGGTTGCCTCGCAGCTGGTTG
TTGATGTCCCGTCTGCCGCGGTTGGCGTTGCCGTACATCTTCTGGCGTCGCCGAGCTTGGCGTTGGCGCGATGGTGGCCGTGGCGGCGACACGGTTGAGG
CAATTGTCATCGTAAAGATAACGGCCTGACCCTACTGTCAAAATCAAGGATAGGTGCAGCTAGGCAGATCGACTGTGGTGGGAGTAAGAACTACCCACAA
CTCCTTTCAAAGGGCCGAAAGGCAAACCCAGGATCAGTGCGACCAGTGAGGAGAAAGCACCACAGTATTGAGTTGCCTTGGTTGAGTAGAGGGAACTAGT
CCGACTAACATCTCTACAAACGCTTAGCTCGGTTGAGACTACGCAGATGACTGACTGCCGTTAAAGTGCAAACGTGAACTTTGAGGGCTGATCCGCACAA
AGTCACGAGAGTTTTAACCGTGAGTTACGCAACGCAAAGTGTACCTAAACACACGGCGTATTGCAATTGTAGTCCTTAACTACGAGCCTTACACTCGTAA
ACCCCTTGAGAGGCGGTACTTAAGTCCTATCAATCTAATGCGTTCCGCACAAGTAATCAGGAAACGAATGTTAAGTCTGTAGAAAGGCGCGGTAGACTAC
GGTGGAGTAGGCGGGACGGCGACAGGGAGACCGAGGCAAAAATTGATGACAGCAGTAACCGCGAAGTTAAAGCTGCCGTGGAAGTGGCTTCGAACAGTCT
TCAGTAGCAGGCGCGACGAACGAGTTCGAGGTGGCCGAGGTAAAGACGGAGGCGGAAGAAGACGAACAAACTGGGCTTGTGCGTAGTCGTGCGGAGGTGG
CCTTTTCTTGCACGCTTGCGTGGGAGAAGGCAAATTAGGAAGTGCACCTTTCGACTTCGGGGGGGTGATATCTTTACCAATCGCGACGAGGCACCGAATC
AACAGTTGGAGTCTGACTACAGGGCGACTTTCATGCGCTCGCATTCCCGGTtggtcctagaccctcgtaTGAATTTTGGCTTTCGCTCGGAGGAtaccgc
tactgaagcgaaggacgcgataaCCTGATCGTCGGGGGTCTCCGAAGTCGGGCTCCTGGCCAGTACAGAAGCCGAGCTTGATCACCGGATAGCTCTGTGA
GCTCATTTTTTAGTGCTTCAagagatcccaatggatcggtaccgcgctcgacttcaagctcagaaaggaggtgctcctgttcCCGCAATACGGACAGCTt
cttgtggtgctcgccctggcaaaaccgctgcggatgacgatgagctctttaagcgataGACTGGGAGCATTCTTCGccgtctaccttacagcgaagccac
aataAAGTGGACATGCGCGTTGAGTGTCATCtaaatttgagtttgtcaagCTCATAACGCCAccgtgagctctgtggtttctcacacgggtgaatCTACG
ACTTCAACAGCTCAGAACCATAGCTtgtgctcagctcatgatccTTCGGACCCCCTGGCTACTGCGAGAAGCTCGTTGTgtttgacgacgcggagcaTCA
TGAtttctctgatcataagcgtccttATCggctgggcagtcttgccgtagtggcacctcaaactcccacgagttctcggagcaGGGGTGTTCTCACCacg
tcacaagatactggatcTAttcctgtcgacgacgtcgatcaacagggcgttccacgtgatagtggacatcatttttctcgtcgagaagagtcggcggtgg
acgatgacgacctggtcgatcgccgttcgGTAACTTGCGATGCttctcgagctcttgagaacAAAGTCCGTCTCCATCGGGGCTCCGCtaagcatcttgc
cgagatGTGCGGAACATctcaagagcttggagcactttgtgcaccgaatGCCTCATGTTGATGtctatcgtgctctgtcagagcggctcctagccgtcga
gcaagctaatgcgtcacttcgtacGACGGTAGAGCGCCTGGCGCCACTGGAAACAGAAATTGCTACACTTCATGCCCGGTGCCAactgctggttcagctt
ctgggtggtcgagcgcctgtgaATATCGTCCCGGCGTCAACGCCTCCACGTTTTCTCTTCTCTAAACGTGAATCCCGGTACGActtaagcaagctcacat
aAAACATCGGGTGGGCGCACATCCTTCtcgaaaggttcagcgtatatgcAAGGCCCCGCGTTGCCACGACCTTTAagggtccgataaaccgtggaacTAG
CTTCGCcgtaaagacagcagaacaTGCATGTATTGAAAGATTTTTAGCATTCAGACAATTGGGTCTTCGATCTACAATtgggtcttcgacctcaaagttt
cagCATgacttctgcttctttcgtCTCCAGTTTTTGTTCATGTATTGGCCTTTAGCCACCGCATCGTGAACTTGTTGTAAGACcttcagtctggtagaca
tgaagtcatcaacttctttacgaacggcaaggagctgacatcagctagccgctcggttATTCGTTCTTCAcgaagccctgagccatgggttgGCGACGTC
AGCGGGGCACGAAGACGAACGagtccgttcacgtagaacggcatgtagTCGGTTGACGCAtgcgctgcattgttcagagcgaactccACACGTGGCAGCA
TGATACTCCAACGCTTTAGTGTCtcagcagacgctgcgaaggacgtcttcAGAACGCGCTTCACACGcccagtttgaccatcggtctgcggatggtccgc
tgttgatatagtcaacttgatgtCTGGCTCCCtaaagattgtcgaccaaactcCCAAGTGAAGCGAGGGTCTCTGTCATTGACAATTGATTCCGGAAGTC
CATGTTATCGAGCGATATGATCCCCAAACAACGTCGCAGTATCCACACCTTCAGTGGTGCCCGGTAcaaccgcaagatgagccatcttgctcaaacggtc
gacaaagaccaccacacccgtgttgtccgccgagtccttcggcaggccaaacacaactgCCAACACCGGTAgactgaccagcggcgccgccgcattcgga
gagaatttcaccctttgacacgtctcacatgtcCGCACATATGCGCCCGTCAATCTGTACAGCTTgtaccaccaatagtggaaactcacagagctgtagg
tgttctcacgactgagatgaacactgagtggggtgccGCGGGTCTCAAAGAGGATACGGTTATtcgaatcctcatcgtgaggaaccacaatccgtggcat
atccgttgaattggtgcCATAATAtggcaacccgttattcaacgaatatagGTGTAACCATGTGTGCAATCGCGACAACACTTTCTTGACCGAGATCCAA
acgccttgctcccgagagcccgtgaCAGCACTATCATACCCGCATATGTGGcgcagatcaaatccgtcacgaacgacgtcaccgtcgtgaaatGAGCAGG
CACATAATCCGGTGTGGTGACAACGCATAAGCTttttggcttatacttcacctcgaagctaAAATtccgcgaagaaggagagctaCCTGGCCctcctctg
caagaggtgatGCCACTGAcccgcagtgcgtagtgatgcatgatctgtgtagataacaaacggcttagagccgagcaggtgcaccctgaagttggcaagt
gcatacttcatcgcaagtacttccttgtcgtggactgggttgttcttctttgcagccttaagctggcgagaatctaatgcgatcacccaatctcgccTTT
TGGGGTCTTCTtgtaccagctaggctggattttttgcgtgtcgtagacatggttcatagagcggagaatgtttaaaGTTGCTCTAAAAAATGTGAATGTG
CcacagacacgcgagcctcgtatgaggcaacGATTAAATGTGACTTGAGGATGTTCACAATTTTAGTCAGGGgcgtgtaacggagttacgcGTACccctg
tatgaaagggcgggtcgcaaaATGGCGAGGTTCAACAATTCACTCGTAAAAAAGCAcatgatggtgtgaccaaacATAGATGTGGATAACTCAagctggt
gtaatcacacagtctgtggctacaccgtcaCAAGAAGCCAACACGTGGCAGGAGTGCCAGTAATAATGCATATTTCTGTATTAATTAGATTATACTATAT
TGATTATGTAtgactatattaatcaggaaaaacTAGGGTTTTGGATTTTGGAGGGTCTGCCAAAACTAAAATAACTAAATACGGTCTTGtttttaaacga
aagagttcaattaccttggctaaggtttaAAGTACTCTTAAAGGcgaagcggattgcgatccgctgcactcgtatcgGTtcatgtaaagaacgtaaggtc
ggtgacttagcttagcttcctttaatcaaagagctacggcagcctcgttGTAGTGAATAGCtccgagaagccatggaagctCCTTACCAACTACGGGGCG
TCGGGCTCTtacgctcgacgctccaagaTAGAAGgaaatcagctgtatgctgaggcgctgaaggtgCTGAAGGCGCGGTAGAGTGACActatcactgttc
gcttagcgacgggtaATGTGTCACGAGTACGAaggttcctgtggacctcggtatcAAGTTTACTAACTTTAACAGCGTGTAAAGCTGCTTAGTTCTAGAc
atggattcaaggtatgacctcatccttggtatgataCGGTTGGAAcacatgagccatggaccGACTGGAGGTTGAAGAccctgggcgctacgcgcacgtc
tcctgatgGAGCATTAAttagtcatgaacccaactCTGCCAGAtagcaaaaacgctattggcgcgtgCGCTGGgccaacgtgctggagatcggagtatcc
aagttggtgaacaccgaaggtgtgtAAACAGGAGTCCCAAGCATgcctcgcgggctgaacgaggagtggcacgtaacccagtGAGCGCTTCTCGAGTATC
AGAGCAGTTGCGGTATATCAtgggtggcatggtcgaacaAGGGCAGgagcatcgagggcgagggcccagtgatgcacgtggagtggtacgtaatctattg
agcagtgctcaagtatcggaacagttgctgcatgccaagggtGGCAAGGTCAGATGAGGTCCGAGACACCTTCGGCAACGCACTTCAGATTCGAGTAGAC
TAGCACGttttccactggacgaagactgcgaaatTAGCGGCTCATCATCGAATGTTGCTGATATTATCGatgctccgatggagcaaggGGAAGTCAGCGT
GTTTCTCTTACCCAGTGTATGAGTCATATGCATTTTGACATCTTCTAGTACTAAGTTAAATCACCCATGGAGAGTATGGGTTTACCTAACCTCTGCTGCT
CTGTACGCAAAATGGTTGTTGAATGAGGCATGGTAAATGATAATATTTTGAGTGAAAAAGCGCTTGCGGACAACTTTTATGTGCTCACTTTTCTTTGGAT
GTGGGAGGTAAGCTCGCACGCATAAGTGTGTAGTAGCTTTTCGTCAGCGCGGCAAAAGACtttggaaaatctaaactgtaACACGACGAAATTACAGCAA
GAGTCGGCGTgactttgcgcttgaagtaGAATAACATGGGCTGCCACACGGTAGCTAGTCGGACATCGTCGTAAGGTTTACGGCGGAGTGTCACAATACT
TCTTGCCGATGGAAACGGTCACGGGCCATATTGCAGTGAGCACCTTATCACTTGGGAGCGGCTACGCCGTGTATTGCCAATTGATGGCAAAGGTGTTTGT
CGGGGATTAAATAGTCACCTAGATTGCTTCATCACGTACTACAAAAGCAGGCACGGTAAATGCAGAAAAGGAGAGGAACCTCGGTTGCAGTGAGGGTTTA
TTTTGCGCAAGGTCTCAAATAGACAAAACATGTGCTAACCCCTTCTGCTCTACATGTAAAGAGGGTGTGATAGGGCGAGTACTGCAATCTTGCGTCCCTA
ATCCTTAACTGTTTTTGGTACAATCATCTTGATTTCGGTAAGGTTCGAAATTCGGTATTCATTTATATTGTATATTCCGAGGAACTTGTGTGCTGCTACC
CACACATCAAAAAAGATGGTCGAATTTTATCGATACTAAGATGTATATCTTTGATTTTAGTCAAGATATCATAAGTCCTGAATGTAAATATTCTTACAAT
AGCAAAAGCAAACTAACAGTGTTAGTTACTTCATAGTCTCCGTTTTGGTCCATGTAGCTGCGCACGATTCCAACCTTTGTGCGGTTGTTTATACGGACTT
TTAGAGTCATAGCCTTCTGCACAAAAACACCATTCGTATGTCGAAATATCTTATCCAACCTAAAGTGCTGATGTTTCCTGACAATGGTGAGCTCATGACT
CACCTAAGCTCCTACAAAGGGTACCTGACTTCTTCAACTTCCATTCAATCCATGGTTCGTGACGTTTCAGCTACGCCATACCAGGTATAAAATCACATAT
CAAGTTCATGTCTAAGACGAAACAACGTTATACTGTTAAATTCATTGTACTTCACTTGGAGTAAAATNNNNNNNNNNGATGCGCACGTGGCATCATCAAC
TTATATTGCGCAGCATATCAACTGTATTGTCTGCTAATTGGCTGTGATAGGATCAGATTTGTTTTGTTGATATATGTGCAAATTGTTCGTAAGATCAGCT
TAAATATTTTCAGCCCAGGTTGAATGTTCCGAGAGCCGGATGGACCAGATATTGTGATGGACACATCATAAGGCTACGCCTTTCTGACCAGTCTTTTGTT
GCTTGGGTCTTTGCGTATCATTTCCCAATATTCCTGACGA