Description :
Non Conding Region
Location :
Scaffold_1:75731- 77430
Sequence
1699 bases(100 bases per row)
GTGGTGTGAGCTGCGACGGTCGAGATGGAGCGAGTGGTCTTGAGGTGTGGTAGTGGTGGATTTGAGCGGAAGTCGGCAAAACCAGAAGTGATGAGGAGGA
AGCTGCATTGGCAGCGCGAAGTTGTCTATCGGTGTGTTGCATTGATGAAAAACAATAAATATCGTATACACATGTTAAATACGCCAAAGCGAGGTGAAGA
GTTGAGAATTGAGGTGATGCTGTGTCCATTTGATGATTTGCCGCGAGTCAGCAGCCTTTCGGTGCGGCAAGATACAGGGCATCGGTTGCGCGTCACGAGG
AAGCTATCCTATGAGACTGCAACAAACGCCACCCTTTTCGATGTATGCTCTGGATTTTGTTGCACTTTGACTAGTTAATCGATCAAGATCGTCTTCCGTC
GTGCGGGAAAGACCTTTCTCTCTCCGGATCTCGCTGGTAGTAATGCACGGTAGATCTATGATAGATTCTATCTGGTATGCACAGGTAAATTGGACACTGC
AAAAGGTACACGCATCTCCAAAAGTCCATCTACCCTCACCGCATGCAAGAAGTAGCAAGTGATGCGCACAACTTTTGTTCAAGTCATCATAACAATACGA
GTGAGATTAAAATGCAGTCTTAAAGAGCAATACTGTATTTAGAGCACTGAAACTTTTTGGAAGCTACATGTACGCAATACTGTAGGCATTTTTGCTTTCG
GCAGCACAACGTTGGGAGTACCAGGAGGCTTGACTCTAAAATACATGTACAACCAGTACACAGATATAGGCTTGAACCCACCTTCCACATCTCGTTGCTC
TGGTATCACGACTCGTGCTACCGTGATTCCCGAGGCCATGCTATGTGCGCAACTGATTAAAATGTTAATCAAACAATGTGAGAAAAAAGGAGCGACCACG
TTGAAGTGCGGACACGAACATACCACTTTAATCTCGACACTCGTCTAAAAAAGTTTATTTCTTTTTTTAAAATCTCTAGATTTTTTTACTCTGTCGTGGA
CTTATATGCTTTACCCTAATGAAATCATGTAGCAACGGAAAAGTCGCATCGTGTTTACATGTTCGCTTGTCTTATTTAATTTAACTAGCTACTGAAGTAA
GGTCTTGAGTTGTAAAATGAATATGCATTTTCAATCTAGCAACACGCCGTGCCTTCGTCCCCATTGGAAACTTGATAATATATACAAAATTGGTTTTTAC
AGGAAAACACCAAAGAAATCGAATAAGAGGCCGTTCATCTCCATCATCGATAGCAAGAAGTCTCAATGCTTGCCCACGCTCACGAGTTCTTTTAATAACG
TCTACTCGTGTGTTTTGATTGCGAAGTGCCTCAATAATCCTAATCTGAAACTATCTGATTTTGCCAATCATTATTTTTTATTTCATTTTTTTTTTTTTCT
TGAAGAGCTCAGAATTAAGGTGGTCTTGGGCAAGACAAGCTTTACCGTGTAACTGAGCACATCTCGAACTTCATCAGAAACAAATCTTACATATGCTACA
CCACAACTTCAACGCCTTAACAACCTCTCAAGATAAAGGTTGCGGACTCACAATATTTACATCAATATCCAGCATCAAAGAAATATGAACCATACCTTCC
TCCTCATCACTTCTGGTTTTGCCGACTTCCGCTCAAATCCACCACTACCACACCTCAAGACCACTCGCTCCATCTCGACCGTCGCAGCTCACACCACCA