Description :
Non Conding Region
Location :
Scaffold_1:75678- 76134
Sequence
456 bases(100 bases per row)
TACTGCTTTCCTTTAGAGTGATATGCGACTACGAGATTGAGCAAATGACGCGGTCGACGTGTCCCTGAATGGCGTCTTCGCCATCTATATGGAGTAGCCA
GAGGGTTGTGTGGTGAGGTGTCGCTTTGAGAAAACCAGCATGCAATGTGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGATGCTGTCACTCATTGCACGCTCGTTCGCAGCCACTCGAAGCGCTACAGCGTGTCAGC
GCATGCCCACACTCGACTTTTTCCTCTAATTCCTTGGCTTGCAGCCAAGCTGGCAA