Description :
Non Conding Region
Location :
Scaffold_1:75645- 76303
Sequence
658 bases(100 bases per row)
ATAGCAAACCACACATTTTTTTTATGATAATTTAAAGTTGCATTGTTGATATTGACATACATACCGCGATCATGCAACACGCGCACCGTCATGTTAGACA
AGAAATATACATACTGAAATGACATGGGTCGAGATTATGAAATAAACCTTCCCTCACTTTTTTCCGTCATCGTCATCGATATCGTACCATCTGCCACATT
CCGGAAAATAAAGTCGTTGCCATCGTCGTCGAACCATCCTCCAACGCCTGGGTTATTCGAGTCATTGGTATCGTCATCGTACGAACCGACACAGCCCGAA
AGATATTCCCGATGATCATCGAATTCGAAGTCAACGTATTCGCATCAGGTCGTCGACAGCCCTTTGATTTGTAGAGCTCTGAATGGGTCTAGACCAGTGT
GTAGCATCATGCAGTAACTATTCGTTGAGAACACCACTGGCTTTGAATGTTTTGATTAGCAGTTGTTCTAAGTCAGGAATTGCAAACAGATCATTCTTAG
TGTCGGATTAAACGCAACTGGAATTGACGAGACAGTCACAGCTAGTTCAACCCTTCTTGCGTGGTCGATATCTATCCCATGATGTGATGGACAAGTTTCC
CATTTCACTTCATCTTAATTATACCACCCATCGTACTCCACTCAGACTTCACAATTTT