Description :
Non Conding Region
Location :
Scaffold_1:75601- 75656
Sequence
55 bases(100 bases per row)
CGTGTGTTCATCCACGGAAAGTGCAGCGCAATGGACCGCATCTACTGGTGTGTCT