Description :
Non Conding Region
Location :
Scaffold_1:75565- 102790
Sequence
27225 bases(100 bases per row)
GCAAATGGACTCAAAGGGCGAAGGAGGAGGCGTCGCGCATGAACTCGAAAGCTCAAATGCGAAACTGAGCCCGAGCGTTCTCGTCGCACGTAACAGCCCC
CACGCAAAGCCCTATTTAGCGCGAACGGCTAGCCGCTTCTCTTCTATTTTATGGCTGACGTACCCGGCAGGAGGCCGGAAGTGGTGAGATGAATATCTGC
CGACGAAATCCATCGCCAATGCTGCGTGAGCAGGTTTCGTGTTCATGCGGGCGAACACCTCGCCCCTCGTTCGAGACAGCCCATGACGACCATGGCCGAG
AGGTGATTTCGAGCGGGGGAAGCTGGACGCCCGTCAACTCGAGCCGAGGGCGCTGGATCGAACCCGTAGGCAATGACGCCTTCGAGGCCGGTGCGCTGGC
CTTCAACGTGCCAGTACGCCACGCAACAACCGACGCCAAAAACTACTTTGGAAGGATAGAAAACAGTCGCGAGCGGCGAGCTACCGGTAGGACTACCACT
AGTAAAACGCCTGAATGGGACGAACGCTTTGACGAAAGCTTAAGCTGCTTTAAGTGAAACACGATATTTGGGACCGGTTTCGACTCGACCGTCGCCATTG
TGGTCGTCACTCAGTGAGAGGCGCCATGACCTCGAGTCGGCAAGGTTTCGGCACCAGACAGCCGCCACTCTCTCTTGAATTGAGGGTGCAGAGGATGGCA
GCGTTCAGAGTGTGGAGGCTGCCTCTGATGGTGCAGATAACTAGGAAGCGACAGTCTGGCTAGGAGTCGTCCGGGCGCTGGGATCCCAGACGCTTGCCAG
TAGTTCCTGGCACTTTGCGTCCAGCAGGCTTGCTGTGTATTGCTAATGGCTCCCACCACTGGAATAAGACTGCTTTGCTTGACGGAGACTTGTCTACCAA
CTATGCATCCCGCCTTCAAAGCCGCTTTCACGCAGCCGAAATATGCTAACTCAATACACGCCTTCTGCGCTTTCTAACTTGGACCGTTGATTGTTTTGCG
GGTCACGAAGATCCCCCGATCATTGACACGCCACACGGGAGGGACAGTCACGAAAAAATGGCTCTGCTGCCGGTGATGTTGCTTGCGCTCGTGTGCACTT
GGTTCACATTGGTGCAAGCCGTACAGGTTCTGTCACGGTCAGGCTGCGCTTGCCAACCCACTCTTCAGCCTGCTACAAACACGACAGTAGCTTGCTCCCA
GACGAGCGCAAGCGCTTCGTTTGAATGTGCAGTGGACCCTTCCGACCCCTGCGCGGATGGAGTGCTGGGCCGAACGTGGGACCTCTGCAATGGTGGGCCG
AGAATGACTCATTTCTCCTTTTACGTGAGCACTAACCGAGTTTCGTTCGCGGTCAGTTGTCGACTTGTACCTCGTTACAGATCGGAGCTCAGCAACTGCG
TCGACTGGATCTCTCGATGTAACTTTGTACGGTGAGGAACACGTTGTGCTGCAGACTGCAGAGCTGTCGAGTGAAATCCTACAGAAGAGGATTTCAAAGG
TTACTCTGGCTTTGGATACCGAAGCTGCAATCAAGACTGTCAAGGTAGGCGACTTTGAAGCACTTGCTTCGTTGGGACCAGTTTACCAGACTTTTCTGCC
CGATGCTCACAGATCCAGGCTGCGGCTAGGATATCGCTGCAGATTTTCGAAGTGCAGACCTCAGTGAACGACTTGCCCCCCACGATATTTTCTCCTCCAA
CACCTGGATCAGTCACGTTCGTGGGCAGTGAAGAGACTACAAGCACTGGTATCGTCTCGCTTTGGTTCGTACCCGTGACGGAGTACTTGAAGGGTAAAAC
AACCTATTATGCTGCGATATGATGCTATCACTTTAACTGACGTGGATTGGTTCGGTTGACTTCTAGGTGCTTATCGTAGTCAGTGTTTGTTTGACCTGGT
GGGACGCTGCGGGTACCACGCCGATCTCCAGGAGAGTTCTGACTTACTGTTTCTATCTGAAGAGGGGAATGAACTAATTGTGGCGGCCAAGTCTGTTGCT
GCTCCATCATTTCGGCGTTTGACTGAGGTGAAGCATCCGCCGAAAGTAGCACCACGTTCTATCGAAATGCTTCCTACAGTAGCTAGTCGTTCTCGAATCC
AGCGGACTACATCACCGAGCTTACGTCTAGGTGTTGCGTTACCACGTGGGGATATTATGATTGTTTTGCCGAATGAGCCTGTGCTGGTACGCTTGAAGGA
TGTACTGGAAGACATCAAGCAAGCACGAGGTGCAATTGACAACCTCGATCTTGTGTCGATGGAAGCATTATGGAGTGCCAACAGTGCGTTTGAATACGCA
AAAATTGATGGCACTTCAGCAATGGAAAATGTGGTGGATGGGAAATCCGTGACGTTTTGGAGATTTCTGCAAAGTAGTTCATTGGTGAAGGTTTATATAC
TGCAATCTTTCGTCGGCGAAAGTGACTTTGAAATCAAAGTTGGCGTCAGGGTGGCAGGGAAAGTGAATCAATACTCTAAGAAGTTCGTCGTGACCATTGC
TGGCGATTTGCAATCTACAAAACCTCCGGAAACCAGCAGCTCACAATTAAAGAGTGGATTGAAAAGCATGTACACTGATAACGAAGAGGTTGAAGCCGAT
GCCGGAGTTCCAGATATCCGCCGATTGACTACTTTTGATCCTGATACGGTTATCGTTAAGTTGCTACCTCAAACGGTCGATCTACAAGATGATACGCCGC
TTCGTCTTTTGGTCGCAGACCTTCTTCCGAACGTGGTAGAAGCGAGATCAGCTCTTTGCATTACAAGCTTTACGATTTTTGCTTTAAGCAATGCGATTAG
GACGATGGAAGTACCATCAACAGGAACCAAAGATGTGTCCGATGTTCACGACCCAACGGTTGAACATTTCTGCAACGAGACTCTGTTGGTCCGACTCGTG
TCGGACGTGAAGAGCATTCAGGCACAGGTACAGGTTGACATTTTGAGCTCCAATGATGCTGTTCTTGTATCGGCCAGTATACCACTTAGTTGGACTGTGA
TCTCAAAGCTCGATACACCAGTACTGAACCAGATTCTTATCGGAGCGCGAAACGCACTGGTCGGCGAATCTATGGAGTTGGCGTTGAATTATTCAAATGT
CTTGACTAACACAAGCGTGGTCATCACTATCAAGAATTGTTCTGTTTTGGATATTCAAACTACTGGAAGTGCGAGATCGACGAACGAAGAATGCGCGGCT
CTTTTGAAAGACGTTAGTGATGATGCCACAGGAGCCTACAGTGGAGTGATAATCGCTCAGCGTCAAGATGTTGCTTCCACTCTCGCTGTTGATGTCATTG
TATCTCAACTTCGGCAAGGTGATGATACCCTTTCTTGGATGATCAGTTCGTCCAGTCTGATATCCTACGATCTTCACTTTTGCGAGGTAACGCAAACGAA
CGGCAGCACACTAGTGGTACGCAAGGGAGAGAAAATCGATATTCTTCCTGCTGAGTTCGCTCAAACAATTCTCGGCGTGAGTCTACACAATTCACAGCTC
ATAACAAGCATCACGTTGGTTATGGATGTCGACTTACTGCCGAATGTTGGCACCTTCGAAATCGATGGTCATCTTGCTCAGGTGAGTTCGTACAACACTA
CTGCTTCGTCCATCGTCTTGAACCCCAGTAAATTCACATTTACACCGATGCAATATGGATCCTTTCTGGTTGATGCGATGCTTGACTGGAAAGATGAGTC
CAATGCAGAGTCTGGTTGTGTCTTTGTGCAAAACTTGGTAGTATCGGGGCTACCTTCGCTTTCGCAACCTGTGTTTGCAGCTCCATACGCTTTCAGCCGA
AGGGTTCTCCAAGGCTCACCTGCCCAGCTAACAATTCCAGTGATAGCTACCAATGATTCTGAGATCGAGTATCTGACACTAGCTGTTTCGGTGAACACCA
CAGATGATGCGCTTGTCATCAAGCGTGATGGCATTGAATATCATCCTTCGCTGGACGACCAACGCTACTATTTCCTCGTCCAACGCGATGATGATATCGA
TATAGCGAGGCAGGTTATATTTTCTGTCACTCCAAGTAGTGCCTTCACCGGAACGCTTTGTTTTGCTGTTGTGGTTTCAGCGATTGGTTTTATGAATAGT
GTAATTCCGATCGAAGAGCTTAGCATTGATTTGTCAACTATTCGCGAACTAGAGATTGAGTGGATCTCCACTGCTGAACCATCGAGCCTAACAGTAATTT
CTGGGGAGGCAATTTATCGGAGCCTCCCAACGCAGCTCCAAGGCAATTCTACGCTGTCTTTCTCGTATCAACTGTCATCCGGTACGGAATTCACCATGTT
CTTTTTCACTCTGATTATCAAGGAATACTACTGACTCATGCTGTGTGGTATCCATAGATTTCTCGAGTATTAGCACGGACGTCATTTTGAACTCAAGTGA
GACTAGACGGGTATGGTCAAGTGAGTCTGCTGCGATTAACCCAAGTGAGTGGAATATTGCTGTGGCACCGATAACCCTTGCGTATGCTTCGACTGCCGAG
ATCATTTTCCGTGGAGTAGTTGCCGTGGAAGATGGGCTGTACTTAAAAACTATCGCTCTTCGAGACTATACGCAGGAGAGTACAGTAGGGGTGGTTGAGT
ATATTCGTGCTACTGGTGGTATGATCTACTTAGAAATCAACACAGCAGAATCCATCCCAGAGCCGGTTTGGTATCGCGTGTACGTAAAAACACTGAACAG
CAACGAATCACCTGCTCTTCGCTTCACTGGTAAGATTCTCATTTCTACCCATTTTATATTCATGCACTATTGTTTCACCCCTTAACGTTTTGGTTATATA
ATTCATGGAAGGTGACGGTCTTCAGTATCTTGGGTGCGAGGCCACAACGACAATGTACCCCTGCGAAGACAGATCAGGAATCCGAGCCATGAGTCCGAGC
CAGTGCAGAACCTTGTGCTCGGCTGTCGAAACTCAGCTTCAGTTTACTTCCGATTCGATTGTTCGCAGTGCACAAATGATGTCTATCCCGGTCAAAGATG
CGTTTACGATTGAACTCTGGGTGTGGTTAGACGACCTTGGTACCAGTGGCGAGCAGCTCTTACTACTATTCGGCGCTGTGGAGGGGAATCTGGCTGTTTC
TATAAGTACTTATTTGGCAATATCCTATTGTCAAAATGAACTTCGAGTTCCTCACGGAGTCCCACTGCAAAAATGGTCTCACCTCGCGCTTGTATTCAGT
GCAAACGACGAGGTGGCAGTCTTGACTAATGGGGTCAAGGTGGCTGATGGCCGACTAAGCAAGGACAACTGTAATATACCAGCGTACGCATATCTGCAAC
TCGGACGAGGTACGAATGCGCATAGATATTCCTTCGCACTTAGCTGGTTTAACCTAATTGTGCTGCTGCTGCCCTCCATTTGTTTGTCAGACACAATGGA
CGTTCGATCAGATGCATCTGTTCTACAAGGGGCAATGGATGAGGTAAAATATGTACACTTCTATTATGGACTAGTGCTACCTACTCATCGTGTTGCTTCG
TGTACTAGGTTCGCATTTGGAAAGTGGCACGCGACACGTTGGCTGTAAATGCATCGTACCAAAGGAACATCGCTGACACTGATTTGATCCTGCGTCTGCC
CTTTAATTCTGCTGAGAAGACTAACTGGTTCCCCTCGGGGACAGATGAAAGTGGAAACAGTGTGGACTTCATGGTACAGAACGTAAGTGTCATAAATACT
CGTCCGATCCTTGCGTTCGGGGTTGCTGGAGATGGGAGTTGCTTCTACAAACTGACTTCAGCAGAGGTTGACGTATTGCCAGCGAACACCTGTGACAAGG
CTTGTGGCGATGGAAGTATGAAAACATGCGGGTCCAGCATCTCGAGCAAACTACATGTTGTGACAAGTGTGTACGGAAAAGGCCCATTGGGCGTTGGTGG
GCTGTCTCCACTTGTGGATTACGATATTTATGTCGAGTTTGTATCTGAAGATGGCGGAGAGTATGACATCACTGGGGCGCTCATTGCGAGCACCTCGAAT
ACTACAGTCCCAGGAAAGGTGGAGTACATCAGTGTCGTAGAACGCTCAGATCAGTCGCTTGAAATCCGGTGGAGCCCCGTTGACGACAACGGAGGGTCTG
TAATCTTAAGTTATTTGGTCTTTATGAATGGAGTCCAGATGGAAGGTACTAGTGATGGAACGACCCTGTCAGTGACGCTAAGTATTCCAGAGATGCAAAC
CAGCTATAATGTAACTGTGCAGGCTCGAAATGCGTTTGGATTGGGACCTTACAGCGACTCGCTCTTATTGGCAGCTGTGTACAGCGAGCCCTCACCTGAG
ATACCGCAAAGACCAAACATTTCATTTGTATCCGGAGGAACCGTGGAACTCGTGCTGGATGTCACTACAGTTTTAGCTGTTGACAAACTTTTGTCTGTGG
TCGTTATCGAGCATCGCGAGATTTCTCTCACATTTTTCACGAAGTCATTTTACCGGCGCAACGGCACATCGGCAACTGTTTATAAGCTCCGCCACAATAC
TGCCTACGTCTTTCGAATAGCTCTAGCCAGCAAGTCCGGCATCCAAAGTGCGTTTAGTATCCCTATTTCTGTGAGGACGGGAAATAGAGGAATGCCACGC
AAAACTCCAGTGCCTTTGGCTACCAAGGCAACAGGTAGGATACACAAGTTTGCAAATTACATTACCGTTCTGTTATCCCTCCCCGCTCATATTATCTTGT
TCACCGCAGGAGGATCAATTACACTGACGATGGAGGAACCACTGGATACAGGTAATGCTTTGCTACAAACCACTTCGAGGTATTAAGCACTAACCATAAC
GTCATAGGTGGTCTTCCGATTGCACGATATAACATCTTCATGCTTCAGGATAATTTGTTTTCGAAGATAACAAGTGTCGAAGCATCAAGTACTAACGAGA
TCACATCAACTACCGTGACGCGCGATGTAGATGACGTCCCACTGCGGGCACTAACCGATTACACCTTCAAAGTGCTCGCACTTCAAGCGGATGTTGTTTG
TGATACATTGACAGAAGAAGGATTGGAGAGTGATGCCGTTACCAAGTCAACGGGCTTTGCCGCGATTCCAGCTCCACCTCCACGTCCATCCCTGCTGCAA
CTGGCGGGGTGTACTGCGGTCATTACTGCTACACCCCCAAACGATTATGGCGGTACTCAAGTTACAGGCATGACTGTTGGAGTCTTTTTGTCAACTGGAG
TCTTGTATGCGAGCTTCGCAGTTGCCTTAGATGCAGGAACAATCACTGTTCCAAGTCTGCTCGCAAACACGAGCTATTTCGTGAAAGTTTCTTTAAAAAC
CACTGTGGGTGATTCTGAATTTGGCGAAGCGCAGTCATTTACGACAGGTGAACCAAGCCAACCAGGAAAATTTGCACGCCTCAAAATCGACAACATTGGT
TCAAGCTCGCTGAGTTTAAGCTGGGCAGGACCACTGAACTCTGGAGGAGGTACCGTATCAGGTAAGTTTACTTCTTTGTTTACACTATGCAGATCACGAT
AATCACAGCGTTTATCGGTTTGTAGGCTACCTAGTATACCAACGTACTTCTAAGTCTTCTGAGCTGGTGTACAATGGATCGGATGATTCAAACACGACGT
CATATTTGATTCGAGGGCTTCTTGCTGAAACTTTGTACGAATTCGCTGTTGTTGGGATTAACCAGTACGGTATAACGAGTAAGGAGGACGAAAATGTGAT
AAATGCTACGACCAGCACCCCCGAGGTACCTGCTATGCCAACAAACGTCAAGGAGAGCGACGTAGGTGGAGGATACATGGAGTTGTCATTCTCAGCGCCT
TTACTAGCTGGTGGATATCCGGTCAAGTCGCTTACCTATTCAGTGCGTTTACAATCGCTATCTTCCTGCTTTGATAGCGCATCCGGCTGTTCTACGTGTT
CGTACGCAATTGGTTTGAATGGTGGTTTCGCTGCGCTTTCAGCAACAACCCCATGCACGTGGGGGGATTGTAATACTGAGCAAACTTGTTGTTTAAGTAA
CGGAGCTACGTGTGGTATTCTACTGATTGAGGTGATGGAATGTAATTCTGTGGCAGGGGCTGATATATGTCGTGTTGAAAGTTTAGTTCACGCTACGATG
TATATTGTAGCCTTGGCGGCAATAAACAAACAAGGAGCGAGTTCATATTCGAGCAGTATCACCGTCCGCACCAGTGATGCCAGGCGACCTGGCACCCCGC
AGCTTAACCTTGTGTCTGCTTCAGGAGGATCGATCGCCTTGAGCTGGACACTTCCATTGGTACGTGCAAGACAGGGTTTGAGAGACCATGTTCGATTTAT
TGATTATCACGTTGGTTTGTACTGACAATTTGTGAATTGTCCTAGGATACTGGAGGTGTTCCGATTGTGCGGATTTCGCTTAATGTAGATGGATACGAAT
TATTCGACACTGAGTCAGCATTGACTTTCACTCATTGTGGAGACCTTCACGCAAGTACTGATTACACATATTCGATTGAGATCGAAAATGCGGCGGGACT
TGTCAATCGAGAAACATCTTCCTTCATGACGACAACTGTGACTCCTCCTGGTCGTGTGACTCTGTTCGAGCCTGTTGTAGGGGTGCAGGTTGCCACAATA
TCTGCTGCTTTACCATGTGATGATGGCGGTATAAATGCCGATCTTACGCTCTCTTATCGCGTTTTCCGGGTCAACGAGGTTCCTGCGTTGATTGAAGATA
CAGCTTCCTGTTGCTCCATCACAATTTCTAGCTTAGAAGCGTCGACTAGCTATCAAGTCGACGTTAGAGCCAAGAGCTCAACCTTGTCAGGTGACTGGAG
CACGATAAGTTTTACTACCCAGAGTGGTATACCCTCAAGCCCAAACATATCGCTGCTACGTGCAACATCTACAACGCTAGAGCTGGAGCTTATTCCGCCA
CCGGTAACTGGTGGTGAATCTCTTTCAATCGAGGTGGAGGCCAGGAACATCGTATCTGGCGATGTAGTTTTTCAGACCACCTTGTATTGCTCTCTAGCAG
ATTTGAAATACGACTGTCCTGATACAGTCTCAATTAGCGGACTTGATTCAGCACAAGACGACTACATTTACGATGTGGCTGCTCGGGCAGTTGGAACTGG
AGGGCCAAGCGATTGGGTGAACCAGTCGTGCAGTTTGGACAATGGAATACCAGAAAAAATTGGCTTTGTTGAAACCATCTATCATGGCATGGAAGGCAGC
GATATTCACGTGAAAGTTGCGCGAGTATATGGTACAACAGCGCAAGACGAAACAAATTTTGAGATATTCTCTGGAACGACAGTACTTTCGTGGTCTTGCT
CACCAACCACTGCTGGGGCAACTTGCTCTGTTGACGAGCAGGGTAATAGCGCAGGTATATCGATATCGGAACCATCGCTGTCATTTTCACTGCTATCTTA
AACTAATTAAATGTTGTGTCTGCAGGAAAAATCACCTTTGAAGCTGGAGAGTTCTTGAAAATGATCACTATTACAGGATTCGATGATGCGCTGTATGAAG
CTGTACCGGTGTCGATAAACCTTACTCTTGTGAATTCAACAACTAGCGAGGTCAGCGATACTCAGTGTGAAGTTTTATTTGATGACAACGGAGATGCTGG
AGTCCTGAAGTTCAGCACCTCACATGTGACAGTAGTTGAGGATATGGGATCAATCGATATTGTCCTTTTACGTACCGGTCGAGTTAGCGGGGTGGTGTCT
GTGACGTTGTTATCAACTATAAGCTCGAGCATTAGTGGAAACCAACTTAAAGAGATCGTGAGTTTTGCAGATGACATGGGTAGTGCAACCGTGTCCGTTG
GTATCCGAAGTAGCAAAGAATACGAGTCCAGGCATTTTGTTTTATCGCTGGTGAACGCGACAGGTGGTGCGGTTTCTGACGGCAATAATTTGACGGTGGT
TGTTACGGATAAAGGAGATCTGAGTCTTCCTGGTCGCCCTCGAGTTGCCCAAAAATCCTCCACTGGAGGATGCATCGAATTGTTTTTCCAGCCACCAACT
TTTATGGGCAGAGAAGCTGTGGCATCGCCTCAATACATTGCGAGCATATACAACAATAGCTTTCAAGCTTCATATACGAGTCCATCGGATACCCTCAACG
TTTGTGGTCTGGTCTCTGATTCCACCTACGTTGCTGTTGTTGCGGTCAATAATTCATATAGACCAGGGGAAAACAGGACGATAAACATTTCAACTGGGGC
GCTTTCAGCTCCAAGCGAGGTTGTCGACCTGAACGCTGGCACTATTAGTAGTGGCTATGTCGAGTTATTGTGGAAATCGCCTCTCGATAGTGGGGGTAAG
TCGATCAGCGCTTACGAAATAACGGTCTTGAATGAAGCTACCAACGAAGAGCGAAGCATTGAGACGGCTAGTTCTGAGCTCACTGCGTCAATTAGTTTCT
TGGCAGCGGCTACAACGTATTTGTTTAGTGTCCACGCTGTAAACAGCGGTGGGCTGGTGGGACGAAGTTCGAGTGTTAGTGCTTTGACTAGCGATGCAGA
GCAACCTCAGCGACCTCCACCCCCTGAACTGATTTACGCTACCGGTGGAGCTTTGCACGTGAGTGTGATCGCTCCTGTTGATTGTGGTGGTGCAGACCTA
GCAACCTACACTCTTGATATTGCTCGCAACACTGGAGAAGGTTTGACTTATCGTCAGTACAAAACGGATGGAATTCAACGCCCCCCTTACGATAGACGTG
TCGCCAATGTCTCCATCTATGGCCTTCTATCGAGCTCGGAGTACTTTCTTAGAGTGTCCGTGTCAAATACGCAGGTAATGCATAAACTTGTAGCGAGTGG
TGCTAATTCAGCTTTAACCCATACTATTCTTCTTCTTTATAGGGGTGGAGCCAGCAGAGTGATGCAAAAGCATACATTACCTCCGGTCCAACACCAGTTA
GCGGAATGGTAGCACCGACTGTACTGGTGGAGGACCCAGGAGAGCTGACGCTACAATGGGAAGCACCGCTAGACTCCGGGGGTCTTGGTATTGTGGGGTA
CATGTTGCAGTCACGACGCATGTTCAGTAACGGATCTTGGTCTCTCTCTGAGATCGTGTACAACGGTCGCTCTTCTACACTACGACAGGCATTGCTCTTG
AATATTCTCGCTAACACTGAATACGCTATCAGCGTCACGGCTTACAACTTTCGCACACTGTGTCGACCAGACGAGTTCATTACACCAGGTGATGAACTCA
ATATTACGACCCTTGATACCTCTACACCTTCACAGCCGAAAAACCTTCGCTCGAAATTGGTGACCGGTGGATCTGTTACTTTAGCGTGGGACCCTCCTCG
GTCTTCCGGGGGAGACACGCTACGTTGGTATCTAGTTCGCGGAGGAATGAAGGGCTTTGATCTCCAACTAATGGCAAATGTCAGTGCTACAGCATCGAGC
TCGATTGCGTTATATGGATTTGCTGCTTTGACGCCTTACGAGTTCGCAGTTGCGGGAGAAAATTCGCGAGGTTCTGGAACATACTCACATTCGGTGCTTG
TGACTACTAGCTCGACGAGTGCCCCTGGCTCTCCAAAAAATCTGCAACAAATAAATGTTCGTTCTGGCGGCGCAATTCAATTAGCGTGGGACCCGCCTGA
CGACTCCGGTGGGGCAAACATTCAGTATTATAAGGTGTTACGCAATGGTACTTTAGTTGACGAAGTAACAACAGGGAGTTTTCAAGACCAGAAAAATGTA
GTAGCGAAAACCCGCTACACTTATACTGTGCTCGCATCGAATGATGTTAGTACGGGTACGGATTCAGCTTCGATCACTGCCACTAGTGCAGATGCTTCCG
AACCCGCTGCTCCATTTGCGATAACAGAGAGCGTTAGCGGAGGGTTCATCGTGTTGAACGTGACACGTTCTGCTGACTCGGGTGGTATTCCTGTTCGTTA
CTTCCGGTTTACAGTGCTGCTGGAAAATACACTGGTTGGCAATTTTACCACTTCGAAACCTTACACTACGGTGTCAGTAGAAGATCTCACGACGACTGAA
TTTGATTTCACAGCATCGGTCGATGAAGTCTTTACTTCTATCATCACGGTGGCAGGGCTCTATGCTGAAACTGAATATTCAATTATTGTTCAAACCGGCA
ACGATGTGGGTGAAAGCGATTCAGCCACGTTGACCGTCACCACCGGTAGCGCGACAATTCCTGATATCATGGTAGCCCCAGGGCTAATTAATGTGACTGG
AGGTCGATGGCGATTTAAAGTCATTCCTCCTGTCAATTTTGGAGGTAGCAAGATCTTGGAATATAGATTTTTCGCGAACGATTCATCTGCGTACGTTGTA
CAAGAGTCTAGCCGTGAGTTTGTTCTTGTTAACTTAACATACCTCTCGTGGTATTCCATCACTGTTTCTGCGATTAACCGTGTCGGAAAAAGTGAATGGA
GTGATGCATTAGTCGGGCAAACATCCTCAGCTACGGAACCCGGTGACGTTTGGGATCTTAGGATGGTCACGAAAACGTACGAAACAATTGAAATTGACTG
GATGGCTCCAAATGACACTGGCGGAGATGCAGCCAACGTTTGCTATGAAGTTAAATACTTAAACGCCAGTGATGAAAGAACGATTGCAAATATTTTGAGT
CCATTAAGATTGGTTGATCTTCTACCGGATATGGAATACTCGATTCGAGTACGCGCAACAAACAACATTGGAGAAGGCCCGTGGTCTACCAGTGTGGTCG
TAAAGACCGACCCACAGTCACCCGGAATAATTAACTTTGAAACAGACGAAGTCACAGTATCGGAAGGGTACCCCTTCGTTCTTGTAACAGTGGTACGTAC
CCTGGGTGGATTTATGCCTGCTCAATGTACGTATGAAACGATCAGCGGTACGGCCCTGCCGGGTATCCACTACACTGAATCTAGCGGCCTAATTGAATTC
GACCGCGGAGTGAGTTCCCAGACGATAAGTATCCCTATCATTAACAACGATGTGATCGATGACCCAGACAATTATTTTTCTGTTTCGATCCAACAGGGCG
GCACTGAATCGGGTGTCATCGGGAACATATCTGAAGTTCGTGTCACTATCACAGACGATGGAGATGCAGGTGTGGTTGGATTTGAGCTGGCGAACTATTC
CGTGTCTGAATCGATGCCAACATTAAGTATAACAATTGTGAGAACATTGGCTTTTAGCGGCGGTGGAACTGTTGCTATCGATACGCTCCATCCTCCTGGC
GGTGCCGTTGATGGTGTCGATTATACTGTTGATAAAATGATTGTGTTTTCTGACCGACAGAAACAGGCATCACTAATCGTTAACATTAGAAACGATACGA
TCTATCAAGAGCAAAAACGATTCCAACTCAAATTGAGTGTACTTGAAGGACGCCTCGCTCTGAGTGAATTATTTACGACTTCGATTTATATATATGATGA
CGGAGATCAGTCGCCACCGGGCGTTCCCACCAGCGTTCACATTGATAAAGTTTCGGGAGGAGTGATTGGAATTTCGTGGGCAGCACCTGAATACCTTGGA
GCAAAAAACCCTGGAGCCATATCTTATACGACACGTGTGGTGGACTTGCAAAGCGGGTTAGTGCGTGAGCAATCCGTAACAGACGTTAGCCTTCTGATTG
CAGAGTTAGCAGCACGAACAGCGTATAACATCTCTATTGCAGCGAAAAACGATTTTTTCCCGGGGGCATACTCAGTTCCAGTATCGATCCTTATGGGTGG
ACCAACAATACCATCCAATCCTGTTAATGTGCAGCTTCTGTCACGAACGGGAGGAATGGCAGCCTTGTCGTGGTCAGCTCCATTTGATTCAGGTGGTGCT
GCTATAGCCAGCTATCGTGTGACAGTGAGCACAAGCAATGGCAAATCGCTTGTGGGTACCTACACTGTAAATGAGTGTTCCGTATCAATTTACAACCTCT
TAGCGCTCAGTAGCTACAGTGTAACTGTAGAAGCTATCAACCAACACGAATTGATCGGGATCGTGAGTACTGCTATCGAATTGACAACTACGACAGCTTC
TACACCTGGAAAGCCTGCTACTTTGAACACGACAAAGATAACAGGTGGAGCACTGCTTGTCGAAATGACACCTCCGGCGGATATCGGCGGCGTTCCCATT
TTAAATTTTACTCTATTCATGACGTCTGCACAATTCCCGAATGCGTTTCGTCAAGTTTACCGAGGTGCAGTATCATCGTTTTACGCAACACGCTTAACGT
TTTCCACAACCTACAAGCTCCAGTTCAAAGTGACCAACGAAGTGGTACGTCTGACTATGAGATGTTTGTAACCCATATTTCTTAACACCATTTATACGTT
TGCTGTCGCCAGGGTACAAGTGAGTTGAGTGATGTGTTTGTTCAGACCACCAAATTTCTGTCGCTACCTGACGAAGTAACAAACCTTGAAGCTCTTTCTC
AAACAGGAGGGTCAGTCACACTTTCCTGGACGCCCCCTGTCGATTTTGGAGGAGCTGATGTTACAGCTTACGACGTTGTCTTTTCCTTTGGGAATTCAAT
CAAGGCACAAAACCGGCAAAGGGTTTCTGGAATCAGTGTTAACGCGACGTCAGTAACCGCAAAAGTGGTGGGGCTACTGGCGAATACAAGCTATGGATTT
TCTGTGTCTGGGGTCAACGACGTGAGTGTATGTGAAGATCCCACTGCACTTCTCAAGCGAAATATTGTTTACAGAAGCACCGAATCTCTGGTGTCACTCC
CTGATACACCTGGGAACTTGGTAGTAGCTGTCAGTACATCTGGAATGCAGATAATACAATGGTCTCCTAGCGCAGACACAGGAGGTGACCCCTTTATAGG
GTATCTGCTTTACTCTGACACCGGTGATCTCCTGTACAATGGTACAGGTACGACCTTCTCTCGTGGATCATTAACGCGAAAAACAGTTTATGGCTATTCG
ATTTGCGCGTGGAACGGTGCAGGAACAAGTGTATCGAGCAAGCTGGTACTTGCAGCTACTAAAGAAGATATAGTTGCTCCGAGTCAACCCCTTCAGTTCA
TGCAAACTGGTAGCACTGGTGGTTCGATCCGCCTATCGTGGCAGAAGCCTTTAGACAATGGTGGGGAAACCCCCATATCGATGTACAAATTATATCGTGA
CTCCCTTTTTAGGGCAGATATCGTATCAAAAAACGCAACCGTGGACTATGTAGACGATCAAAATCTGCTCGCACAGATGAAATATGTGTATGCCGTTCAC
GCAACTAACACGGTTGGAATGGGAGCGATGAGTGAAAAAGTTGTAGCTACTACAACTATTGCAACTGTACCTAGCCCCCCTAATCAACTTGATGTTGTTG
CAAAAGGTGGAAATCTTACGGTAACATGGTCCCCTGATGCAAACACAGGTGGTATTGATCTGACATTCTTCAATCTGGAGGTGCTAGTTGATTCGAGTGT
TGTATTCAGTAAATCTTTGGAGAAGACTCGGTCATCTTACATCATTTTCGGTACCAGAGCTGACACTTGCTATACTGTTCGTGTGATGTCTAAAAACGAC
GTTGGCGAAAGCATACCGGCTACTCAAACAGTGACAAACGGCGCAACAGTTAGCCCGGCAGCGCCAAGAGCTCCTGAGCAAGACACCACATCTGCTTTGT
CAGCATGGATGATAGCGCTGAAGCTATATCTGCCAATTGATGACGGCGGAGCGCCAATTTCCCGTTTAGTTGTGTATCGGAATGGAACAAAATATGACGC
CACTGATATAAGTCCTACGGATCAAACGGCACTGGGGGATGGAACAAGCCGCTCCATATTAATCGAGCTAGGGCCTTTGCGTGCTGGCACGGTGTACGCT
TTCGTTGTCTCGGCCGTTTCTTCCATAGCGACAATTGCTGAAGGTGCTCGTAGCGATGTGTTGGAAGTATTGACACCTCCTGCAACGCTTCCCTCGGAAC
CCCTCACTGTTAATGTCGCATTGCGTACAGCGTTTTCGGTTTTCTTGGAGTGGGGTGCATCTACGGATACAGGAGGGGATGATGTCGTCTACGATGTTTC
CTATGACAACCTGAACACAACAGAATCGAGTACAACTCAGGCAAACATCACCGCTATAGAGATATCCAAGCTAATGCCAGGAAACATATATGCAATCCGT
GTGCGTGCTCGAAATTCCGCGGGAACAAGTATCTGGACACCAGACGTATATACTGAAACGGATATAACTCAACGCGGCGTCGTCACTTTTAATTTGGCTT
CTTCAACTGTGTTTGAAAATGTCACGAGTGTTATAGTCGATTTGCTTCGAGTAAATGGTTCTTCGAGTACGATCACATGCAGCATTTCGGTGGGTGGAGG
GACAGCTGTTAAGGATCTGGACTATACTCTACCGTTCGAGTCGGAGCGTTCTTTTACATTTGTGGGAGATCTCATAAAGCAAAGTTTTGTGGTGACTGTA
ATCAACGATGAAATTTACCAGTCAGCCCCACGGACAATCATTTTTTTCCTCCAGGACACAACTATCGATCGAAGCGATCCATTCCCACTGACAACTATCA
CACTCACCATTTTGGATGACGGAGATGCTGGAACGATCGGGTTTGCAAAAAACGAAGCCGTTGTCATTGAGAATGCTCGAGTATTAGCGCTTCCTCTGCA
ACGCCTCAATGGAAAGAGTACAGCAACTAGTGTGCGGGTTGTTGCATTTGGTGGTCTCCCAAGCACAACGCAACCTGAAATCGGGTTTCGTTTACCTATC
GACTCCGTCAACTTTATCGACAATCAGGTTTTCGAAACGGTAAGTATTGTGATTAAGGATAACGATGCATATGACTTTCCATATCTGTACTTCTATCTGT
CCTTGGAAATAACAGCCGGAGCAGCTCAAATTGGAACGAATAGTGTGATTCGAGTTGTAGTGATCGATGACGGCGATCGCTCTGCGCCTGGGAAACTTGA
ATCACCTATGCTTGATAAAGCAACGGGAGGAATGCTGCTACTAAAGTGGGAAGCTCCTGTCAACGTCGGTGCCCAAGATCTCTGGATCATAGGCTACAAC
ATTTCTATTCGTACTGCCAGTACTAAGAAGTGGATAGTAACGCCGTCGAATGCGACTTCGCTACCCTTTGGAGGATTGAGTGCCCTGACCAGCTACACTA
TAAACATTTCAGCCATTAATGCGATTGGGCGTGGTCCAAGTAGCCCCAACGTCACTTTCCAGACTATCGATCTTACATCTCCGGGAACAGTCTCACAGAT
TGCGTTAGTCAATCGAACGGGTGGGCTGCTTACGGTCAATGTATCCGCTCCCCTGGATACAGGAGGGGCCCCTATAACAGGATACATTTTGTACTTTGCT
GACCAGAATGAAAATACTAAGGTTAGTACTCAAACCCGATGGTGCCACATTACCCGTCGAAAAAAGCTCACTGTGATGCTTGTTTACCCAGGTGGCCTAC
AATGGCACAGGACTACCTTCATCGCTGATCCGTGTCAGTGTTACCAAGGCAAATACGGTTTATAATCTCCAAGCAAAGGTGTGTAGGTTTTATTTTCAAC
GACTTGACTAGTTAAGATTGACGATACTTCTACGTTATCACAGGCTATTAACTCTGTCGGTCCGGGAGATTTGTCCCAGTCATTCGCATTCCTAAGTGGA
CCCCTATCACGTCCAGGACCGCCTCGACTCCCCACGGTTCCTTTTTCGCGAACGGGTGGAGCAATAGCGTTAGTTCTAAAGCCTCCAGTTGACACAGGTA
CGTATTTATTACCCGTTGTTCCTATGATCCAAAGGAGAGTCCTACTGAGACACCTACATGCAGGTGGTTACGAAGACATATCATACACGATATATTACCG
GGAACAAGGAACGGGAAAGAGATTTCGTCAGGCATATTGCAACACGCAAGGCTTAGACATCACAGTTTTTCGTTTGGCAGCGGATACTGTCTATGACATG
GTTGGAGTTTCAATTCTCAAAGAAGATGTCAACGCACTTGCTGAAGGAAATATTTCTCTTTCCGATTCAAGTATTGTTCTTTTCGAGAAGAATTCAAGTA
TCCTGACTAAAACCGGGTACTTCGATTTCGGAGTAAGTGCTTTTAAGCCTTCTTTATGATTTCCATGCTAACCATCTTATCGTGCATTTAACGAATACAG
GGATATATCTTCGAGGTTGACTCATCACAAACTCAATCGAGCACGGCCATAGTATACTTGCCATCGCTTAGTGCAGGTGACGGATCCATAGCTATCATGG
ACTTGATGAACTTCGATGTGTACGACATTTTTGTGCGTGGTGCATACAGTGACGTCGCAAACTTCACTACGCTGGCTCCAACAAGACCAGGGGTCCCACC
ACAACCTGTACTGGATTATTCGACAGGCGGGGCACTTAATATACGCATTTCCTGGCCGAACGACACTGGTAAGTTGCACGATAGCGTATTCTGTCTTGAG
CGAGATTAACCCATGCTGTAACGGGATACAGGTGGGGTTCCCATAACGAGCTACGAGTTTTACATTGACGACAACACGGTGGGAATGTAAAAATGCAATT
ATCGGGAAACTAATGATTAACGCCATCACATATACTTTAGGTGGACGGGACACTGTACAGTTACTTACCACAAGATGACTTTGCCCTCGAAGTCACAGTG
CAAATTGGGGGTCTAGCGCCTGAAACAACCTACAACTTCTACTATATTCCGATAAATGATGCGTCAGCATGTCCTGGCATGGATGACGATATTCCTAAAA
GGGCTACGTTTGAGACGGACGTAGCCTCCCTTTCAGACCCAGTTCAACTGATACGAGCTTCTGGAGCAACCGGAGGTGGAATCCACGTCGAAATGAAAGC
TCCGAACGACAGGGGTAGCGATAGTGATCTATATTATCAAGTGTACATGAGCCCAAGCAGACCAACACCAGTTTGGACTCTTGTTTATAACGGCACGGAT
AACGCGTATTGGCAGACTAAGCTAGAGAAGGTGACTGAGTATTTGTTCAAGGCTACGTGTATGAACGAAGTCGGGTACTCCAATTCCTCGGCGGTCTATC
CACTCCGAACAACGCTGGTGTCTTCTCCAGGGCCCCCAAGCGGTTTGAATTCAACAAATGTAACAGGGGGTATGATTCATCTTACTTGGAATAGTCCAGA
TGACGACGGCGGTAGTGCAATCACTTCCTACTCAGTGTACGCGAAAGATACGAGTGGTGAGGTGGATTTGGTAAAAGATGTGGAAACGACCGACGTTTCT
TTTGGGGGATTGCTTGCAAAACGGAAGTACGAGTTTAAAGTGTATGCGGTAAATAATTTAGGAACAGGATCGGATCCTGAAGTGGGAAGCTTCTCAACTG
TGGCCGCTACACTGCCATCAGTACCCGGAGAACCGGTTGTTATCAAGTCGTCCGGAGGTGCAGTAACTTTAAAAGTGCGTGTACCGGATGATACAGGTGG
CATCAAGATTGCCGATTTATCGTGTATTGTGTACGCGAATGGTGTGAAACTACCAGCAGACTCAGTATTACTACTGTCCACTGTATCTATGGGAGCTCGC
CGTTTGATATCAAGGCAGCTTGCGACGGATGGAGAATCTGTTATCTATGTTTTAGCTGGAGGATTATTCCCCTCGGTGACTTACTCATTTACCGTTCAAG
TGACTAACGGCGTGGGGGCAAGTGACATCACCAACGGCATCGATGGCACAACATCAGTGGTTTCCGTTCCCGGTGCACCTGTGCCGCCAACGGTAGTAAC
AATTACTGGTGGTGCTCTAGAGCTGGCGTGGACAGACCCAGTGGACACTGGTGGAGCTCCCATATTATCATACAGACTCCGTATGACGAGATCAGATGAG
GAAGTAGGAAGCTGCGAAGGGATGATTCTATCGTGCACCATTGGAAATTTGATGTCTGTAACAGATTACGGAGTAACTCTGATTGCTTACAACCCTATCG
GAGAGTCTCCGCCCAGTACCCTTGTTACGTTCACAACTGGAAAAATTTCAAACCCCCAAGAGCCTCTGAACCCCCGTATAGCGAGTGTGTCCAACGAGTT
GGTAGTCATCGAATGGAATGCGTGCATAGACTTCGGCGGGGCTAATGTTGACACCTATCGCGTGGACGTGGTAGAAGTAACAACTAATTCGATGCTCTCA
GGTAGCGTTCCATTGGCGCAACAGAATATCACTATCACCGGCCTGACTCCAAGAACAGATTATGTTGCTACTGTGGTAAGTTTGGTTCATCGTTCATTCA
TGGTCAGTGAAGCAAACTTACAGATTATATTGTATTCAACAGCGAGTAATTGGGGATGGTCTGCAAGGGAAAGCGAGCAAGATCATCTACTTCAAAACGC
CGCAATCGTCCAACCAGCCTCGGCCACCTGCAGTTGGATGTCGTAAGCGCTTTCTGTAATTTCAGATGTGTCAACCTTTCTTGTTGCTAACGATACGCGT
TTGCGTTATGTGTAGATTCACGAACAGTGGCAATCATTTTTTGGGAGGCTGAGGACGATGCGAACAGCTACTTTCTGTATCGGAATGGAAAAATGCTAAG
TGACAATGGAGACGACATCACGTTTGAAGATACTATTGAAGTTGGTACTACGTATGCCTACAAAATTCAAGTAAAAAAGCTGGACGGAACGCTAAGTGAC
TTCAGCGAAGCAACTCAATTTGTTGCAACAGCTCCGATCTCCAGCGGCTTTGATTGTTTTGGTCGCAAAGGCCATATTCATTGGCACGATTACCACAATT
CCGATCACGAGACGTGGACTATTAGTCCAGAAGACCAAGCCGGGCTCTTGATAAATGTAGGTTTCTTGTCTTGCTCGACATCTAACTGCGTGGGTACTAA
TCTGTTTACTGGTAACCGCTACCATGGCTAGATCACAATGTTTTCTCTCGAGTGCAATCACGATAGCTTAGCCGTCAGTGTAAAAACGAGCGGAACGACT
ACCCAGCTATGGAAAGGCGGGTGCCAGCGGGAAGGAAGCTTTATTATATCAACAGCAGCTAACATCGATAGCGTCACACTTTCGTTTACATCAGATGGGA
GTATAACCTACGAAGGGATGGCACTATACTACGAATCAGTGGATTCTTCAGACGCCGTACAAGCTGTAACGGTGCCATGTCCAGTCTCGTCGAGTGGTCT
ATGCTCACTAAATGGTGCTTGCCGAAGCGGTTTTTGCTCCTGTTTTAGCGGCTTTGTTGGGGAAAGCTGCAGCAATGCTGTCATTTGTCCAGATGATACC
ACGACGTGTACTTCTTCGACGTGCGATCCAGTTTGTCTTCAGTCTCAAAACGATGTGATTGTGGTAAGTGTAAATGGAGATGATATCCAGGGAACCGGTC
AGCGTATGGACACTTCTCAAAGTGGAACAGATCCGAAAGCTGTAAAATCTCTCCGACGAGCTCTAGAGCTGGTGCAGTCCAGCCAGACAATACTAATTTA
TCCTGGTGCGTACGACGGACCTGATAACTGCGGTGTGACAGTGTCAATATCGAATATTATTATTCGCGGGCTGAGGGGCGCTGCAGCCACTGTCATTGAT
TGTAAAACCTTACACCGTGGCCTAATTATTGACGGCGCCACGGTTCGGATAGTTGGATTCACACTAGAAAACGCTATTACTAGTGCTGATGGTGGATCAA
TTAGTGTATCTGGCGCAAAAGTACAAATTGAGGACACATACATCATCAACGGAATTTCGCAGCAGTCTGGAGGTGCAATTTATGCCTATGACTCAGATAT
TACCCTCATTGCTACTCAAATTAAAAACAGCTCCGCTGCTATGAATGGAGGAGCTATTTTTCTGGATAGCTCAAGTCTCGTTCTCGATCATTCCGTCATT
CAGTTTTCAACAGCAAGTCAAGGCGGAGGCATATTCGCTCAAAATACCGCCAGTGTACGTGGTGACTCTACAAGCAAGCTTTGGGGGAATTTGGCTACTG
TAAATGGTGGTGGTATATGTTCCAGTGGGGAATTCGATGCGCAGACATTAACCATCGTGCAAAATTCTGCTCTAGTTGGTGCAGGGATGGCAGCAATTAA
TGGAAAAGCAACGCTCTTGAATGTAGAAATAACTAACAACAGAGCAACCAACGACGGAGGGGGGATCGCACTACAAAATACTGCAGCTGTGTTTTTGAAA
TCCTCCCCAGTCCGCTTGAATCATGCCGACCGCAATGGTGGCGGAGTTTACGTGGGGTCTAACGGTACATTTGAAAGCAGCTTAGGGTCGGAGATCTCCA
AGTGCACAGCAGGTAAGTTGATGCTTTAACATTTCCACACCACATGTATTGGATACTAACATCTAGTTGGCGAATACTTGCTCGTATAGCTTCTGGAGGA
GGGTTGTATGTCGATGATTGGACTCGTCCAACCATCAACGGTATCGCTGTACTCGCTTCGTCAGCTACACTGTCTGGGGGTTGTGCTGCGTTTTCACGAA
CGTCGGCAGCTTTGAACATTGCAGTTCTCAAGGGATGCAATGCACCTACAGGAGGTGGAGTCTATGTCAGAGCTGGAAGTAAACTCACGATATCAGGTGC
TTTAATCAGTGAAAACACAGCAAATATCGGAGCTGGAATGTACATCGATTCTAGCACAGTCGTAGGAGTAAATGGTGGGCCATCATCAGTGGTTCGTGAC
AACCAAGCTCTCATTGCAGGAGGGGGTGTTTTTCTTAGTGGAACACAGAGTTCTTTCCAGTTGTTTGACGTACTGAACTGCTCGGCACCTCAAGGAGGAG
GCATTTCCGCACACAACGCGCTACTATTGACGATAACGTCGATCCACATCTTTAAAAGCAAGGCAACCATTGGTGGCGGTGGGTTATATACTAACGCGTC
GACGATCACAGTAACAGATACGAAAGTGACCGAAAATGTCGCGGTGGTTGGTGGTGGAGTGTTCGCTGTCGACTCAACCCTTTCTGGTAGCATATCCATT
AGTGACAATGTGGGAGATCGAGGTGGTGGAGTGGCTACTTCGGGTTCCACGATGCTGGAGGGAGCTTCTATCTATTCAAACACAGCATTGCAGAAAGGAG
GAGGCTTATCAGTGGAGACGGGCATCTTATCATTGAAATCTACTGCGATCAAGTCGTGTTCTTCTCCGTCTGGTGTTGGCGGGGGTGTATCAATTTCAAG
CGCTGAAGTCAGGCATTATGCATTGACCGTTCAAAATTGTTCATCGCTTCGTGGTGGAGGAATTTATGCTAATGCCTCCTCGTTCCACCAGTCTCCACGT
ACAGAGAGTACTGGTATCACTCTGTATGTAGCAGCAATTTCCCAAAATCTTGCAGCCGAGTATGGCGGAGGTATCTTTATTGACGGAGAAGGAACGATTA
TCAGCGATGCGATAATAACTAGCGGCAGTGCACCTCTCGGTGGCGGGCTCGCAGCTCTTAAGGCTAAAGGATGTGTCGCACTAAATGTTGGCATCTCTTC
TTCAACTGCCACGAAATCGGGAGGAGGCCTTTTTTTCGGTTCTGGTGCGAATTGTGTATTCCGAGATTCCTGGGTGACAGAAAACCAGGCGGTAGAATCT
GGGGGTGGGTTGATGGTTCAGGATGCTACATTGTATCACTCTAATGTGGAAATCGCCAGCAATGTAGCCCCAAGCGCTGGTGGAGTTTACATAAAGAGTG
ATTTGCTACCGGCTACTTTCTTGTGGTGGAATGATACTGCGACTAAAATTTCCCGTATCCGCGCGAATGCCATCAGTCCTCAAGGGGGGAATGGAGCGAA
TGTGCTGCTTAATTGTACAGACACGTGTATTCTATCGGGTACTCAAATCTCGGATGGAAACTTGCAGGTCGGACAAGGAGCGGGGATGTTTGTAAGCGGT
AATGGCCATACATCGATTTCAGACTCCTTGATTGCAAACAACTCCGCTGTACAAGGTGGCGGAATCACAATAAGCGGCGGAAACATAACGGCATTCAAAA
ATGTAGCTGTGGTGGGAAATGTAGCAAGTGATGGTGGCGGTGGATTGTTCGCGGAAAGCTTGCAGCTATATCCACCGGAGATTGATCTTGTCAACTGTGT
ATTTTACAACAACTCAGCAAATAACTACGGTGGGGGGATCCTACTTCGTGCGGTATACTTGTATAGTTCATACCTGTTGGTAGTCGAGAATCGTGCGGTG
AATCGTGACATTGGCAGCGGTGGTGGTCTCTACGCTGAGAAACTAGCGAGTATCATGGCCGACAATTGGTTGTTCTTATCGAATGACGCAACAATTGGTG
GCGCGATTACTGGAGTGACCGGTTCCGAGGTCAGTCTCCTCGTCGCCTACGTCACTCGTGACTCAAAAACATTTTTTACGGAGACGTGGAAAGATCTTTT
CCGCAATCTTGTGGGTTTCGAGTATGTAGAAGAGAGGGCTAAATACGATGTGGCCGTGCAGAGAGGTGGCCTGATCTACCTCTCCGATAAAGAATCCGTT
TTGGAGCTCTTGTCATCTTACGCGACGCACGGATCAGCAGACGCTGGAGGGGGGCTCTATATCAACACTAATGCTTTTTTTTACAGTGAAGAGTCCGAGA
TCAGCTACAACAGTGCTAACGAGCGTGGGGGGAGTTTGTGTGTATCAAATGGTGCTCAAGCTTACTTCGTCAACGTTCAGGTGATACGCAGTGGTAAGTT
ATGTGTCGTTCGTAGAGCTGATGTGGAGAAGCAAGCGAAACTAACTGGTGCACATTTGTTTTTGCTGCACCACCAGAGTCCAAAACCTCTGGGGGCGGGA
TCTTTGTAGAAACATCGGGTAAAGTTTATGTGGAGAGCTCCAACGTATCGAACAACTTTGCTGATGACTCTGGCGGGGGTATTTTCCTGGACACGGGAGA
GAAAAACGCTGTAACTCTGAACGATTCCTTAGTGGAACAAAACATTGCGAATGGCGAAGGATGTGGTGTCTTTGTTGGGCGAGAAGCTATCCTTTCTGGC
TACAAGTCTCAATTTGTGGGGAATGGTGGGATGACGTCCAGCGGAAAAAGTGAAGGTGGAGGTGCAATATCTTCTGTTGATGGTGTTGTGAAGCTCACAA
GTTGTACTCTTGCAAACAACACTGCACAAGTTGGAGGGGCAATTCATGTTGACCGCAGCGGTACAGCAACGATCACTGATTCGCATTTCGTGGGTAACAC
TGCCGATCAAAGTGGCGGGGCAATTGCGACAAATATAAATGCAAAAGTCACCATCGCTCTGAAGACTTCATTTGAACGCAACAGGGCAGATGTTGGTGGG
GCCGTTGCAGCGACAGACAACTCTACTGTCTCGCTATCATCGGTAATACTCCAGAATAACCAGGCCAATGGACAAGGTGGCGCCCTATACGTTACCGATC
AAGCGGAGCTTACGTTGAAAATGGGAAAACTGATTAGCAATACTGCCGTTTCAGGCGGCGCTCTCTATGGTGATAGTCTGTCTATCGTTGGCATCTCGGA
CTCCCAGTTTATCTCTAACACAGCATTTTCTCGTGGGGGTGCACTCTACTACCAATCCATTAAAACAACTACGACTACAAGAATTTCTTGCACCAGAAAC
ACTGCCCCAAGCGGTGGGTGCATCTTCTGGGAATCCTATGATGAAGATCTGAAGGTGCAGCACCCATGTACATCTTGCACCATGGAGTCAAACGCAGTAT
ACGATATTGCAACAAATACGAGAAATGTTAAAGTGTTGTGGTGGCCTGCGAACATAACAAGTGGCGTAAAAATGCTTGAACCACCGGATGAGGAATCGAT
TGAAGCAATTGAAACACGGAATGAAACCTTGGAGGCCACTACGTATGTATGGCCTCGACTTCAGGCTGTCGACTTGTACGGGCAAATTGAAGTGCTGGAC
AATCGAACCGAGTGTGTTGTGAGTGATGGCCTGTGTAGCGAGCAAACTGAGCGGGTGTTGTTTGAGCCCCGCACTCCTGTTCGTGCAGCAATTGGAGTGA
TTTCCTATCGCGAATCGTCTTTCACTGCAGCTAACCGAACCCCTGAAGATGGAATTTACACTACACACGTGTCGTGTGATCTGCCGGAGTCAGAAGTTCG
GTCTTTCGACATGGACGTAGCGTTGTTACCATGTCAGCCGGGGTTTTCAGTCAACGAAGGGTGAGATCAAAGACTTAACTTGCCGAGGCGGACTGAGTTG
CTGCGATTAATATCTTCGTGCTTTTGCTTGAACACCCAGGGTTTGTGAGCGCTGCCCAAGAGACATGTACAGGTAACTGCTGATTGCTACTAGGGCAGTG
AAGATTTATTGTGTCTTTTAACCGTGGTATTTGTGTTGGTACTGTCTGGAAGTTTGGATGGTATGAAGTGCTTTGACTGTCCGTCCGGAGCTAAATGCAA
CATGACCGTTCGACGTGCTACGGAGACAATTGCGCAAGAACTGGGCACCATTTCGCCACGCACTCAGGAAGGATTTTATTTGTTTTCTGCTCCAGCGTCA
AAAGAAGAGTCGAGTTGCTTCAAACCTTCTCAGTGGAAGAATGATGATCCATGCAAGAAGGTTGCCCTGGAAACCCCGACAAAAAGTTTATCGGATGTGA
TCTACGAGTGCTCAAACTACAATGACTTCAACGTGTACTGGGATTCTGAGCGACTTTTTTCCTGTCTTTCGGGAAAAGCTTTCTACACTTGCGATGTAAT
GCTGTGATACTCAATATTTGATCTAGGTATCTACTAACTGGATTGTGATTTCGGGTAATTGCGTGTAGGTTGAGGGGGCCTGCCAGGCCGATATTTCGAT
CCAGACGATCAATCTAGCCTCGGAAATGGCTTCGACAGTGAGCAATGTGTCATGTGCTAGCGGATACGATCTGACAATCTGCTCAGTATGTGCCACCGGG
TTCAAGCGAGCCACGGACAACTCCTGCCTGCGTAAGCAGAGCTTTGAATCGTTCACCTCGTTCGAGCAATCATAAATTCTTACTGGTATTATTTTGTTAT
GTAGCATGTGATCAAGCCAACGCTAAGGTTCGAGCTTCAATTCGATGGCAGAACTTTGTCATACCAGTGCTATTGATTCTCGCACTTGTTGGTGGAATTT
ATGGAGTCCGAATTTATCTGCGAGACCTTACGGAAATTGGTTTACTAGCAAAAGCTGAGGCTGATAGACGGCTTAAGCTTCCAAACTCTAAAAAGGGTGA
GACAATTATTTTACGTGCTGGTAGGAACTATCGGAGACAATCAATGGTAGTGGTGGGGCGAGTGGATCGTGTGAAAAACAAACTCAAAGCCCTTTTCAAG
AACTACCAACATCGAAACGCAAAAA