Description :
Non Conding Region
Location :
Scaffold_1:75473- 76716
Sequence
1243 bases(100 bases per row)
GTACGTGTTTTTTATCATGCCAGTGGTCGAGAAACTAAAAAAACGCATGGACGTGATCGCGCCAGAGGGAGTTTTACCTATAAACGCCCGCTCCAGCACG
TCGTCGCAGCGCAAGCTGATTCCATACAACGTTCTAGTGCAAAACGTCGTTGTGTGTCGAGACAAGTGGTTGACCAAAATGACCAGAAGCACTGCGTAGC
CTTCATTCAATTCATGTACCCCTTGGCCTAATGCGAACTTTTCGATGCACTTGCACACGAGGGATTCGTATCCGTACAATATTTCAAATCGTTGAGCCCC
GGCGCCGCGCTTTGGACTCGAGGAAACACAGGAATACGCGTACGGTCTGATCGTTCATGCCCGACTCAGCGATTTAGCGCGCGGATCGTGACAGCGAGGC
GGAATGACGGTAGACCATCACTCAGAAGCCATCTCGGTCACACAACGTCGCAGGCTCATTTGCATTTGGACACGATGCTCCACTTGTACGCAGCGACCAA
GAGCGAGCCGCAAAACGCTGTGTGGTCCAAGGCTCGGAGAGCTATCGCTCGTGCTGCGACGCAAACACCACCGCCTCTGCGATGCACCTCTGTCACCTCA
ACGCTTGTGCGCCACGAACGAACGCTTCTTAGTCCCATTCTCGAAGAGCCGTGAGATTCGAGCGGTATATTTATGGGAAATATACAGCAACTTGACGTTC
GTGTCTTGGGTGTCTGTCATCGTCGTCTTCTAACCATAGAGCCAATACGCACCACTTCTCGCATGTAATGCAGCGTAGTGAGGACCGAGGTCGGAACTCG
GAGAGCCCATTGACATGTGACAGAGGACGCATACGGTTGTTCAAATCTGTGGCCCACTATTTACTTGCACCGATGCGTGGCGTCGCGCGTCGTCTCGTGT
CTGCCGCGTTCGTCGCAGGAGCTTTCCACGTCTCTTCGCCAGGCCGCCACACAGAAACGTGTTGACGAGGAAGAGCAGCGAGGGTCTGTACCCAGGCCAC
CGAAAGGAGACCACCGCCCCTCGCGTGTTTGGCGACTTTGCCGTTTCCACATGGATCGCCGTGAGCTCCAAGATCATACAACCCGCGACACCCAAAACTT
GTTATATTGGTACTTGTGTACATGGTACGCACGCTGCCACTTCTGGTGTCTCTTCCTAGAATTGCATCTGATATCCAATCTGGTCACCTCTCGACACCTC
TCGACACCGCGCGGCTACACCGGCGTCACTTTACAATTCGCCA