Description :
Non Conding Region
Location :
Scaffold_1:75405- 76304
Sequence
899 bases(100 bases per row)
GTGGGGCAGgcgcttggtcttcttgcttgcttcttcctctctgTTTGTTGTCTTGTGCGCTTTTGAGTCTTACTGgattctcttcttcctctttaAGTGA
ATCACTACGCAGCACCAACCCGGGCGATCTTCTATTGCTGGCCTTATTCGCGAGTGGCAGAGAGCGTGAAAGGTCGTAAGGTACAGCAAGAGGTCGACTA
GGTGCGAGACATTCACTCCTgaggcaacttcaactgctggtACTTGCATGTCATCGAACCATGGATCGCGCAATGCTACGCTGTGGTAGCAGCGATGGGT
CTCCGTTTCATAGGCGTGAGCTGCGAACAGACTTGGCTCAAATACTGCTGGGAGCATATTTGTCAGAGATGTTGTAAAATGTGTAGATAGATAACTACTA
TAGATGTAGTGCATCTGCATGAAACTAGCTGTGGAACGGCTTCGTCTCTACAATTTGTCCATCACAACTGTCTTCTATCGTTGGGAGCAGATAGTTTCGA
TGGATGACAACCTTTCAATGGTGAATGGCGTCTTCCGAATGCGTAGCGGGGCTAAAAAAGCTCCCTGTTGACGAGAGCGCAGCCCTGAATGTAGTATTCT
ACAAATAATACTAGTCATGGTCCAGCAAGAGAACAACAATTTGAGAAAACACCACACAGCGGCAATTACATGTATGAGTACCAATTTACGttcatacatg
tagctgggTCGTGTTAGATCAGTACTCTTCGTACTGTACTGATTTAACCTATCAACttgtgattggtcaaaaatTTGCCTTTCCTCCAATCACATGTAAC
CCCATCGTGTGAGGCCCACACGCGCCGCCTCACCACCAGAAGCACAAAAACGCACCTGCACCCCCAGCACTTCATTGCCCCTCTAGATCCCAGCCGAGA