Description :
Non Conding Region
Location :
Scaffold_1:75387- 75741
Sequence
354 bases(100 bases per row)
actggtcggccttgattatgagggggatctggataatgttgctggagcaacataaggtcataatgttgctcaatcgaattgtgcgtttcatacccaccgc
ttcacttcaagatggcatcaccagcagctacggacgcggtggccaaggcgctagagcggatacgacaggtaaaaaatggagagcgagatgttaattcagc
ggcaatggcctctgtgccatcggcaatgccagctgctcagcctgctgccgggtttcaggtcatttgttctggtcaagtggaaagagtccatgtacgttcg
tccacaacaattgctgcgctaaccagtacttatatcgaagctgtgactagtacc