Description :
Non Conding Region
Location :
Scaffold_1:75318- 77284
Sequence
1966 bases(100 bases per row)
GTGACTTGGCGACAGACGGGACGAAGGGGTAGTTGCTTGCTTGATCGAAACTTGCGAACTGGACTGCCTTGGACTCGGCAGCTCTGGGCGCTGCACTCGC
GGCAACGTGCTGAACAGAGCTCGGCTGTTTTCCTAGTTAATGTCTCTTCCGGGACACCTTCGACCCCAGAAACCTTCATTCCATCTGCTACGCCTGGAAT
CCCCATATATCGTCGAGTCGAATCGCCCGAAATTCGCGCTCCATTAGCGTTTGGCTCGGGTTTTAAGACTTGATAGTCACCGAAACCTGAATTTccgaaa
atcagatgtccgaaactaggccgggaacaacccatGTTGCAAGAACGCATACCTCGTCGAATCGAATCGCGCAACTAAATTTAACAAATAGCAAATGGCT
CGGTTTTGAAAATCGATAGTCGGCGAAACCGCATCAGGCACCCGAAATTAGGAATTAGCAAATGGCTCGGTTTTGGAACTCGAAACCTAATTCCAGAAaa
tcagaaatccgaaattaggccggaaacaaccgatattgcaagaacgcatacccagtcgcgcacacaagaccgcgccataggtctttctggatccggaaga
aactggttggcatactcccgcccttatacaagtttgtgcgtagtgaattacgtttctgggtagtacatttttggccagcacttgtggactccgactgctc
gccgccgcgcgagcagcctccgcaggcggtcaacaacggcaagcgggggagcagcacaggcagggcgaggtagcgtctacgagagattctggctctcgtc
agcactagaggtcgaagttgtaatcgagcgtagcgagagcacttgtgtgggagaatgacagttcaaaagtgagcagtgctagattgtgttgcatcgggga
aagcctaaaccaaacccccttacggttaacagtgaccactccggGTGGACAAGGGcggcacatgatccatcccggaaaactccgcggagtatttcctgga
tctgcccttctcccatagtcacaaccacacacaactttcactacttattcttatcgatttcttactggaatgactagcctcaacggcttaacttcaacgc
tctgacttcaccgttgaagTCTCgtagcgtccacagcggtgcgacgcttgcagcatcgtcgagcacgcccatgtccacgAACGAGCCAACAGTAACGTGT
CAGCGGCAACTCGAGCTGGAATTGtcgcttgcaagcgcttccatcgtgccgctttgtgtctgcaccagtagctcggaatcgaatggaagctcgcactgtt
cgggtagtgcacacacatgatcaggcgAACCAAGCTATCCTCACGCCCCGTTCAGGTTAGCCTGGCTGGACAAGCCGTGCAGCGATATTGCACGAAGCAT
GACTTTTCAACGAAGAGCACTCTTCCTTTTAAAAAAGAACATAACTTAACAAAGAGAGGTTCTCTTTTGTAAAAAAAAAAAATCttaacaaagagcctct
atttagcgaggattcgaacggtaagccgcgccttatgtgccgtgtaacatggtcatccagacgctgaagcccgtactctaatcgcaaaCTCGGGTTTTGC
GACGCTATCGGATATACAAATTGCGTTGCGAGTGAAACACGAAGTATGCGCATGCGCagtcttccaaacagacgaacacaagaagaaggccaaagatcct
tcagcatcctgaagaaactgtttggcatactttcgccgatatataagtttgtgcgtagtgcgtaaagtttcgtaattttgggtagAGTTTTCGAATGCGC
CGCTTTTGCCGCTGATTCTGTTGTGCGATGGTACACAGATCGTACCCCAAATCAGCTAGGGTTACGATAATCTGTATCAGCAAAATCAGCCGGGGTTACG
AATATTGGTAACCTGGTAACCGTACCCCGCACAAAGCTGCAGGAAGATCGGGAAGCGAGACGGCGA