Description :
Non Conding Region
Location :
Scaffold_1:75277- 86025
Sequence
10748 bases(100 bases per row)
GTCTCTCTCGGCCGCAAATGTGATAGTGAGGGGCGATGGCGATGGCTAGCGCGGGATCCAGGAGATGATGCACGCTCAAAGGTATCAAGAGGATAGGCGA
CTGGTGCAGCCCATAATCTGCGACGGGCATCGGAGTACCGTTTACTCTCGGGGAATGCAAGGGAGTCATTTGATTCGGAGACCAGCATCGAAAGGTACAT
GTACATCGACCTGAGCTGCCTGTCTTGGTGAGTGATGCTGCTCGCGAAGTGTAGTGAGTCGTTGCCGATGACAAAGAGAGTTGCTCGAGCAAGAAGGTGC
TGCGTCAGTTAAAGGACATGTGCATGTACTGTATGTACTGTAGCTTCCCGCTCCTCCGACTTCATCACTTTCTTTAGCATTGCGTTGTGCATTTGACGGG
CCGTCAAATGCATCAATGACGGCGTAAACCTGTTGGATGTTTCTGGAGCCAATCTCTGAGCAAGATCCTGAGTTCAGTCCACCCTGGTGGACGAATTGCG
TGACGAACTCGTTGATAAAGGGACCACGGTGGTCAGCGGGCCATCATGACGTCCCCAAGCAGCGTGAACAAAGTACACGAGTTACAGTATGCATTACAGA
CAACGAACGACTTACAAAGCCGGCAGACACAAAAAGCCGGCAGACGAAGTCAAGCAAAGCTTAACATGAGCAAACCAGCCAATCAGATTCAATCAAATGA
CTTCATCTTTGTATACCATCTGGTTTTGTGTACTATATATGCTTTCTTGTGTACTTTATGCAACACACCGTGTGTTTTATGACAGTTTTACAGATTTGAC
GGGAGGGAATTTATCGTTGTTTTTATATAGGAGGATGGCATTAAGCATGCCGGCTTTGTAAGTCGTTGTCTGTAACTTCTCCAGTAGGGATGGTATTGCG
GTCGAATATGGATGCTGGTTGGGGGGACAGGCGCTGTATTGCGCAGGTTCATGGACGCTTGCTGCCTTTGGAATGCAAGATTCTCGCGCACTGGCCAGAT
GAGCCGGAGCGTCTGCGAAACATGGTCCTCCCCAGCCGCTCCCGGCTACTGTCAGTACATACGTGTTTTTGGCGAACACGATGTCGGCAAATCTCACGCA
ATAATTGGTCGCACGGGGTATTGGTGTCTGCAAATCTAACGCAGCCTGTATTAGTCATGCTCGTTTCCAGCATAAACTAACAGTAAACAAGGACAGCCGA
CAGCCAATCCTGGTTCTTCCATAGCCATGCACGCAACTGTGAGCACTTTAAGCCATAATGCAGCAGAATCAAACCGTCTCATTGAACATTGTATATATGT
GTACGAAGCGCGATCAGTTTAATGCCCCTAAATTGAAACGTGGATTGATATCTAACCAAGATATAACGGAAATTCCCGAATAAAACCCCTGATCCGTGTA
TTACAGTCCCCTCTAAACGTTCCCCTATGCGTATCCTAGGGTTACATCCATACAAAAGTCAAGTATTTTATGACTTTGTTGTCGAAAACATGATTACGCA
TGAAATACTGTGTATTACTTAAGTATCCATAATTTATTTGATTTTGTTTGAAAATGGGAGGGTACTAATAGATAGTACTCGGGGTATTATTCAGGAATTT
CCGTTATATAATTTTAAAGTTGTCTTTTTAAGCAGCTCTCTCTTTTTTTTCGTATGAATGCAGTTTGATAAATCTACACATTTTCTAAGACGAGGTCTAT
GACACGACACTCATATCGATTGCAACTTGTCAACAAATGCCTGTTCACTACTGTAGTATCTGAATATCCTACGAAGTAATACAAGTTCTTTCGGACTGCA
TCTACAGCAGGACAACTCGACGAAAAAAAATATACGGCACCCCCTGCAAGTACTCTTACAGTGCACTTAGTGCATGCACAAACTTTCTCATGAACGGGAT
GTTCTACTGGAAGCAGTGAGTCCAGTCAACCCTGCTTCCATCCATTCAACTCCAGCGCCCCCCCCCCCCCCAACAGACCCTCATTCCTTCATTCCAAAAT
TTCCTCTGCAGACCTCAAGTTTCCACAACGGGCGATCTTCACCTTTGACTCCTACCCACCCAAAGCCCTATACCAAGTATGCATCTGACCTCTATCGCGC
TCGTTGCCGTTGTGGCCACCAGTTGCATCGTGCGTTCCACTGCCACGATATCTGACCCGGTCATCGCTCAATTTTCCGCCACCGCCACCCGACGAGTGTG
ATTCGTTCTCCGAATGAAGCCCATCAAGACGACAAGCGGTTCCTACGCACGCCCGAGGCAGAGGGCGAAGGAGAAGAGAGAGGGCTGGACTGGCTCAGAT
CCAGCGCTGCCAAAGCGCTGAAGACCCAAAAAGCAAATTGGATCAAGAGCGCGCAGATTTACGAGGATCTTATCATGCAAAGGAGGACCACGTGGGACGT
GTACACGGCTTGGAGGGAGCTGAACGCTTCGCCGGAAAAGATTGAAAGAGCGATGGCGAAGGTTGGCTACGGAAGCGATGACTTCAAGTACATCGTGAAC
GGCTACAGGGATCACCTGGAATACATGAAAAATGTCCAGCTGCACTAGAACGCCTACGCCTACCTCGGTACAGTGCGACGACTTGGGGGCATCTTTTCAA
GGAGGCAAAGCTCAAGAAGACCAGTCAGGAAAAGGATAACATCATTTCGGTGGCTGAACGCTTCGGGAACGGGTTGAGCGACAGTGGAAAGCAGGGAGAC
GCTGAGATCGCCAGTAGGTAAATCGAGGGAAGGTCGATAGAAGGAGTGCGTGCAAACCTGGTACAGTACAGCGGGCGGAGAAAGTCATAGCCCACCCCGA
GCTACCTGTGCGGGTCAGTATACTAAGACCAAGTCAAAAGCATGTGCAAGTGAAATGACAACAGCGCTTCGACTCACAAAATTGCCATTTCTTCTTGGTT
TCGCATGAATCATTCACCATTCGACGCGGAATCGTTTGAAGTATAATCTGCTCGAATTCCATTGACTATTAAAGGCTGGATTTTGACGAATCGCCGCTCG
AATGAAGCACGGCCACCCGGTCCAATCTGAGTTTATCTTGGTTTTTGTACCAGATGGTGAACCTCCAACGCCTGGCAAAACGTGATGAATGCCCTCAGAC
ATTGCACGATATCATATCTCTTTCTTGGTTTCTCGGGATCGTGGTTTGCTTATATGGATGACAACATGAGTACCTTTCGCCTCATGTGTGCATTGTATCG
CTAGTGTTGCTGGATCCAACTGGGTAGGTCGAAACACTGGGTCATCGGGTTTGCAAATCGTTTTGACTTACTATATGTATGTGGCGGGCTTGGGGTGGGC
TATGACTTTTTCCACACGCTGTACATCCGCGCGCATTCGCCTTTTTTTTCTTTTGCACAAGTACTTTCACCCAAACAAATGTTGTATTCCGAATGTTGCT
TCAGATTTCGCGCTAGGTCTCCATAATACTCTTGCGGTACTTATGTCTCTTCATCACACACACAGTCCCGATTGCCCGTTACAAGTAGGCCATTGCAGAA
GTTAAAGATCCATTCGCAATATCTTCTGCTGTAGTACTTCGAAGTAGATGGGCGTACTAACTCGAAATCGAGTGTCGAGGAAACGCCAACTACTTAACTT
CTTTAATTTTTTTAAATGCACCGCCTCGCCGAATAAGACACAAATGAACTGTACCGCAGTCCCGAGTTTGCCTCACCCAACATCCCTTAGCTATCCCAGC
CTACTCAAAGCTCTCGCAATACAGTATTTTTTAAATAGGTAATGCACTGTAGATTTGACCGATTTGATCAAATCGCACGCAATCTATTAATCGGTAGGCT
GACTCAGTATTGCGTGAGATTTGCAGGACGCAATCTCTAAAATTCTATTTCACTACGCATACTGTTGCGTAGAGCGCAGAGAGATGACCACGAACGCAGC
TCTCGCCCACTCAGCGAAATTGGGATTGCGGGATCTCTGCGCCCAAGCACAGAGTCGGTTAGATATGGGCTACAGTATGCAATACAAAACTCAAGTAAGC
TACAACGCAAAGCACGCCTACCTTATTGTTGTTAATAAAAGGGTCAATACATTGCAATACCTGATAATTATTGTGGAAGTTAGTATTGGACATCGGATGA
ATCGATAATATAGCTACTTATACGGAGGAAATGCAAGCCTGATGCTTCCAATGATGTTTGAGCTCCAATCTTCTGGTTTCTTAGTCCTAGACTGAGGATC
CATGAGCATTTTGAAAAGTGCCTCGAACTGAAAGTGTCTATTTCAATTATTGTCAATACTACCCTAATTAGAAAATATGGGGAGGGTCCGCACAATACCT
TATTGTCCCCCTACAATAATACCCCTTTTAGATTTACAATATATTTTTGGAGAGCCCTGCTCGAAATTAGGGGAATGATAGTCACTGTAATTGTGCTTCT
GAACAAGTCACACTTCTTTTTCAACTTTTGTTTTCTCTTCCAACTTCTTGTTATTGAAGCTTTCATGAATTTCGGCAAGTCGTATTATTGTTTATATGGA
GCCGCATACGGGCCTTTACCCGATTCGGCAAACGTATTCACCCAACTGTAGAGGTTCGCAAAGAATGAAAGCACAAGATGCGAGAACGTACGCTTACATC
TGAGTTTTGCTTTAAAAAAATGCTACGTTAGCACGCTCAGGCCCAAGATACCGGCTCAAAGGGGAAGCTGTTGACGTTTGAGGGAGCTACTACACTACTA
CTGTACTTTGATGGCAAAGGTGCGCTGAAGTGCGAATGGCTTTGCCTAGACCCATTGGAGGATAGCACGGGCCCCGATTTTAAAAATTTTGCGGCATCAC
TGCCCTTATCAATGAGTTGAAATCCGTTCTCACTCCGTTAATGACCAGCCCCTTTACCGTCCTCATCGCCTGTCTCCTGTCCCAGCGCCAACCTATAGCG
AAAGTTAATATCCTCACTCAAACTTTATTGTTTGTTCCCGTCAGCAAAGGATAAAACGCCAAGTGTGAATGACCACGAAGTCAGTAAAAAAAACTTTGGA
ACTTTGTGAAGTAAAGGTCACTCCACAACGGATTCGCCACACAATGAACCCGGAGCCTCACGACGATTTATCGCGAATGAGAGGTTTCCGTGGCAAGTGT
ATGGAGTCTGGATGAAGGTAAATGTTTCGCCGGAAATGATGAAAAAGTCATGAAGCAGCTGAGATTCGACAAGACGTTTACAAGTGCATCGTGCTCTGCT
ACATTCAGCACCTGGAGTATATGAAAAACGGAGTAGCACTTTCGTCCCAAAAAGATGCTTGCATCGTCCGTTGCGTTTTTACATTAAAAAAAAAATCGTC
AGTCCTTTCTACCTTGCGTTTTGAAGAGTAACCTTTTTATCAATTTAGCGAATCAGACGCTATTACATGCAGTACATGCAGTATTATTAAACGCGAACGC
GGATAAAACATCTACAACTATGATTGGGTCGTCTTTGACTCCCAATACGTAGCGCAAATCAAGTTGATTCCCATCGTACGCGCAGTGGAGTAAAACAAAC
AATATAAGATTGCAGTCTTTCGTTCATGCAACTAGTCGTCTTCGACTTGGCTGGGAACACCTTTGATATAAAACGCTGGTGCAGGTACCGGTGCTGATAA
GGGAGAACTGTGACCCGCGATATTCATGGGTGTGGCCCCTGCGGGGCCACACCCATGAATCACGCGGGTCACTGCGCCGCAGTTCACTTTCTGAAGCTGG
TGCACGGGGCTGTTGATGTCGATGTGCATTTCCTGCCTCAGTCTGTCTTGCTGCAAGTAACCCTGATCGGTCGACATCCTTCTGGCTCGTGTAGCACGAA
GGTAGCGCCAGGTTACGCTAACGCGTCCAATTAATCCGTTGGGAGCTGTCCACCCCCTTCTGGTGCTCCCAGTATAATATTGTGCTATTTAGGCATCTCA
TGGCCTAGTTTTTACCACAGAGCGGTATTAATATTCGGAAAAGATAGCGCCCATGTTTTCGGTTGGAGGGGGTGAAATTGACTCAAATCTATCGGGAGTG
TCTGAGCAAAATGGACACCAGTGGCATTTGAGAGGCACGAAGAGCCTGCAAACTTCACCGCAGAGCGACGTTTGGCAGCTTAAGGTCACCTTAGCCCATG
GGCTTTGCAGCATGTTTGCCGGCCATGACACCCGTCCCACAAGCCGAACATGTTTGGCCATGCTTGAACATGGTTGACCGTGTTTGGAATTTCTTACTTG
TTTTCAGTATGTTGACTACCCTAACCCGTTTAGAAAACATGGGCTGTATCAACGGCCATTAATATTTATATGTTGTGTTGTATTGTGCTTGGCAAATGTT
TTGTCGTTTTGACTTGGACCTCTCCTCGGTTTTTATCATTAAGTCGAGGTCGATTTAATAAAACGAGGTCAAAGAAAGGGACAGATCGATCTATTTAGGC
CGGCTAATAACTCGAGCTACGACAATCCAAATCAGGGCTCGAGGTCGATCTCCTGGTGGATCTGGGCAGAACGAGGTCGATCTACGGTAAATCGATCCCT
TTTGCGTTTTCAAAAGCGCAATTCGAGGTTGATCTAAGTAAATCGAGCTACCGCCTCTGTTTTGTACCCTGATTTGTGGGCCTTCCTCGATCTAGGCCAT
AAAACGGGGCGACATTTTATCTGCAAAGCACAATAAAATCAACACGACTATAACCGCAACATGAATAGTTGTGCATATATTTATTTCCACAAAGCCAATC
AGGGGTCGCTGTTGCCAAGAGTCGTTGCTAGCTAGCTCCATGGCGTCGGTGCGGCGATTGCTGTTAGCTGTGGGCTTCGACGAAGAGAACGACGCACTCT
GTCGATTCTTGCGACCTCAAGAACCACCAAGCAGCGAGTATCGCCTTGACCTTCCTCTTCTGACCTGTGAACCTCCGGTTCTTCAGAGAGACGGGGATGG
CCGAACTCGAACCAGCTCGCAGTCATTGACGGAAGACCTGCTACTGTACTTCGTTTTCCGGAAATTTGGAGCCACCACTGATTGTGCAGGAAGCCAAGTG
ATTCTAGGTATCGAGCAGCAGACGTTGGTTCGCTGGGAACAGAATGCCGTTCAACAACCAAGTGAGCTCATGGACTCTATCGACACGTTGCATGGGTAGG
GTTTTGAACCAATTTGACCCATGTTTGAGTGGTTTCGGATAATTTGAACTTGTTTCGTGGTAATGTAGACTTTTGCTGAAGAGCGAGTGGGATGCTGCCG
CGAGATCCACTCTTGGTCGAGTCGTTAAGCGACTGCAAGATCCTCGAGTTCGCCAGCGGTTTATAACATTCGCCTTCCAGATACTCCAAGCTTCTACGCA
ACGCTGTGCTAAAACTTCGGGGCACATATCGGGCGATCAAGATGCCAAGTTTTACGACGAAGCCGTTCATTTGCTGCTACTCGGAGTAACGGACTTGTGG
TCTGTCATTCGGAAAGACTGCGCCAAGACAGCGGCAGCGATTGCGTTCAATTTCTCGTCGCGAGGTCACATCGAGCAGTTTATCGACAGTTTGCTCTGTG
TCGCTATCGGTTCTCGAAGTGTGAGCGCGGATAAAAGCCAGGTGACGGCGTGGACCGAGCGTGAGGGCGCTTTACTCGCGCTTTCTGTTCTTCTGCGCTC
TATCCAAATGGAATCAACTGGTGATAAATCCGTGGGCGAGGGCGACCTCAAAGTTTCGCAGGTTAAGGACGATATCAAGGGCATTTTGGGCGCTCGTCAT
GTGGCTGCAGTGGAGTATCGACTTGGGTCTAACCACACGTTAACCCAGCTACCAAGATGCCTAGTTCAGACGCTGAAGCCTGCGATATATCAGTGTCTTC
GTCACGACCAGCTCAGTGTCCGGCAGTTGGCAGCGCAGTGTCTGGTGGAATATGCTTCGCTGTGTGAGGAACCGACCCGTCTTCTCATCTTCCAGGAGGT
TATCAGCAAGTTAAATCGCATCAACCGGAACGACAAAGTCGAGATTGACAGCGCCACCGACTCGGAGCTGTTGGATGCGTTCGAGGCTGAAGGTTTACTG
GACGTCTTAGCTCGGATGGCTCCCTGCCTACCGTCGAGCTTCTTGCTTAAGCACTGGAAGTTTGTATTCCCGACGCTGGAGAAATACGTCATGCACATCG
CATCCAGCGTTCGCCAGAAGAGTAGCACTGTTGTGCTAGCGCTGGCCAAGCAATACTCGAGAAGTCACGGGCTCCCAGTGTCTCGTGAGGCCTCCTTAAG
ACTGGTAATCCAGATGCTGCTGTCGCTATCCGAGCCCCGAAGTGATGAAAGCGAATTTTGTTGGCAGCGGAAAGAAGGTCGGCTTTTGAGTATCGACGTC
CTTATCAACGTCCTGGGTGAGAGCCTTCTGGCGTGTCCGTGTGAAGAGTGCAAGTTGTTGAAATGGAAGCCAGAATCAACACTGATCCACCAGCGACGAT
CGGGTTCGCTTAGTGCTGTAAGATCTTTTCTCTGGGCACATGACCAAGCTCAGTCGGCTACATGGGTGCTTGATATGGAAGACGCGAAGGAGCAATCGGT
ATCTCCCACAGAAAATTGTGCTCTCGTTCACGCTATCGGCGTATGGATCGACAAGAACGGTGGTCAGAACGGCCTTCCTTCCTCAAGTGATGCATTTTGG
CAGCAGGTGATGAGTGGATGCGTCGCTCAGATGAAAGAGGCGTTCGAGTCGTCACAGTTCGAGCTCCGCAGAATCTCCCGTCAAGTTCTCCCCGGACTGA
TGAGAGTTGTCATTTGGACGGAGCAATTGGCATTCCTAACCTCGACGGAGCTGGAAAATTCATCCCCAGAAACAGCGTGGCCTTGGTCGTGTTTGAAATA
TCTGCTGCTTCACTTGCGGTATCAAGATGAAAGCTTGGCAGCTTTGGGGGAGAGCATTAAGAGCTCTGTGTCTCAAAAACTAGCTGGAAATTGGGGAATT
ATGTGGAGTGCCATTGTCGCTTTGGAGCGTCCTATGAAGAGTTCATCCGTCGATGCAGACACGATCGTCGCTCATGTGGAAGTAAAGCTGATGGGATTTC
TTAGCTATGGGGCAACAGCCGAACCGACTCGAGACGTAACTCGACTCTTGGACAGCGCGTTGCGATCAATTAACGCGAATTTGCCCGAAAACATGCAGCT
ACGAACACTGATAGGGACAGCGTCAGGCAATGCCAACTCTCTAGACCGTCAGTTCAGCATTTTCATGGTGCCAATATTTCCTGCAGTGGTTACAACGCTC
CAATACGTGGCCAATTGCGATGAAAGTGTTGGCTATACTGTTCAACCACACGAAGGCGAGTTATCATGGAGTTCTCGGTGGCTTTGTCTCGAACAGATCG
CGTTGGCGTGGCTTGCCTGTGATGATATGTTCCGGTGGATTACTCTTAGCAAGTCTGAGGCTCAATCCCTGCTCGTAGAAAGCCTCAGTGGGCTTCTGCG
TTGGTCGAAGACAGATCTACCGCCTTCTGAAGAGAGCGAAGAAGTTGGCAGAATCGTCCGATGCCTCGAAACTGCGCAGGTAAATGGTACCCGGCTGAAA
GAGGCAACCTACAGTGAATTGGTTGAGATTTATCTGCGACTATGGCTTCGGCTGATTCAAAGCGGACACCACGACGCCGCGAAGGTGGTCATTGCCACTA
CCCAACTCTACAGCCGCCGACTGCAATACGTTGCTGGACCTGACTCAAACGCAAAAAGCAGCTCGACGTGTCCAGCTGCGGCAGAATGGGACGACTGGGA
TGAAGATGAAGGGGAAATCCAGCAAGCGTCCCCCGTCAGCGCTATCCAAGAGCCCCATGGCGCGCTCGAGTCGGACTCCTTGTTCCAAGAAGTACTGGAG
TCACTTGATGCCACTCAGCTCAGACTGCTATGCGAGGCAGCGCGTGAGATCCTGAACCTGGCTGAAGTGAAAGAAATCTCAGTTCAACACATCACACAAA
TGCTGCAGCAGATTGAAGCTAGCCAGCACACCAAGTAATCACCGCGCCACAGGGTAAATACGTATATTTCATCAAACACTTAGCCATGCACGATTCGAAC
AGTACCACCATTCAGCTTCCGAAGTCCATACTCACAGCGCTCAGCACACTCAGTTCCACCAAGTTCCACATCCACAAACAATGCGCCAGGGCCAGGATCA
CCACAAATAACGATAGTGCAAGCTCCCAAGTCAGCATTTCCTCTAACGCCCACTCGGTCCTCTCCACGGGCGTCTCCACAGCAGTCTCCACCTTATTCCC
CATATCAAAATCCTCCGGCGAATGTATCTGCTCTTCTCGTACTTCAGATGACGGTGCTGCTGTCTGTTCTCCAGACGCTCGAAGTTCTTCATCCCCACTG
CTTTCGTCCAGAATACTCCGTGTCTCTGGTTCCAAGTAGTCGCTCGAGTCGAGTCTCCTTGCGCGCGGACCGTCGCTGGAGAAGTAGTCCGTGATCACCT
GGTTCGACAGCAAATCCTTCTCGCCCGGCAGCATCACCGTCGCCCCCAGCGCTTGGTCCGTCGCGTCCAGCTCGTTTTCCTGCACGGATTCCGTCTCGAA
GCTGCTCGAGTTCGTCTTGGCGGCCATTTGCCACGCTCTTCTTGAAGTGGATTTCTTGGAGAATGGTGATCGGCGACTGCTCCTGCTGATCGAAAGCCGT
CAGCGACAGTTCCAACCGTCGCACTCGATCGGTGAATCTGAATCCGCTTCAAGGTTAAGGATACACTCTTCCCAAGTTGAAGTGGATCTAGTTACGGGCT
GCGGATCAATTCGCGTCCCGTATTCCTCATTGGTACGTGCTGCACAGA