Description :
Non Conding Region
Location :
Scaffold_1:75090- 76896
Sequence
1806 bases(100 bases per row)
ACCATTGAAAGGCTATAATACAACGGCAATAAGGTGCGCGCATGTGCTTCGGAGGTTGGGTTCTGTTACATACCGCGCGTTCGGCTGTCGTCGCTTTGCA
AAGCATTTGCGTCGACGTCATTGAAACAGAGCGAAGCCCATGAAAACAAGGAAGTGCTGAAGGCTTTTTGCTGGACTGGGTTCGTTGAGAAGCTTCAAGA
ACTGCTCGATAAAGAGAGCGTGAGACAGTCAAGTTCTCTACCCAGCGAAAGAAGATGAAGGCAAAACAGTCGAAGAAAAGCGACAGCATGCGGCTGTGAT
ACGTACAAGATATCGGAGATCATCATGACAAACCAAATGCGAAGAGCGTGCAACTTTGCACATGAGTAGCAGATCCATTTGGCGAGAAGTTGCACTGCGT
CTCGTGTCCAACAATGCGTCGTGGCGCGGAAGGAATGCCTATCACTCGTGAAATCTGCTCGTGAAATCTGCTCGTGCAACATGGCACGCGTCCTTGGAGC
GTTTTAGCTCATTTGCGGATCGCCCATCCTCTTCCGCTCCATTGGCTTCTCTAGATTGTCGCGCAGGCGGATGCGCAGCGATGTTGAACTTGGAATGGCA
GAGATTTACGAGAAGCTCCAGCGACTCGCAGTCCGCATAATGGATCAATGGATCTGTTGCTGCTGTATCAATTGATATCCATCGTCTTCAGTCTCGAGAA
TGAATGCAACACAGTTTGGAAAGTGATAGGCAAATGTGTATCCAAACATCCTTTACCCAAAGGATCATTACCCTATGATATTGTACAGACCGACCACAGC
AATAATTGTAGCAGTAAGAGAATATTTCACAGGTGGACAATTGGAAAGTTAAGCTATTACTAGATTGTGCGCTGTTATTGCTGGCAACCAATTCAGCACA
GGCTATGAGAGGTTATTCGAGGTGCTGTGCCAACCACAGTGATACACTGTGAAGCTTGCATGCAGATGGGCAAGCATGTGTTGGGTTCAAGAGACCGAAT
AGTGTCCTTTGGCTCACAACGATACAGTAGTCACTCAAGTGGGGGAGTGGATAGGCTAATAATATGTGTGCCCGTCCCACGTTTAGCCGATCTTTTCTGG
CTCACTAATGATACAGCTGCTGCCCATAATAATAGTGTGCTTGTGATGCATTAACATATTCGAAAAGCGGGAGCATGCAGCTGGTATCTCTGCGTTCCTC
CGAATTAGACTTAATTAAAGTATGCACCCTCATGAAAACGATGGCAAGACAGGTGGACGATACCGCAATAGTCTGCAGTTGCAGCAGCAAAACAAAAAGA
ACCCAATGTAGCGAACCGCATGGCGCCCAAACTAACTCCGACGAAGAGTCAGCAATTGCGCTCTATAGAGCGCGCGCCCTTGCGACATGCGCGCGCGGCC
GCTCCCCCAATTGGCCGCATTCGCAGGCGCCCAAAACGAGACATTCGGTCGTCTTGCACCGTGCACCAGAGAGAGAGAGTGCGCGCGTTGTCTACGGACG
CATCCTCGGGGGCATGGGGCGCATTCGGCGGCTTCACACGCCCCCGAGAGCAACAGAAAATCGAAGAAGAAGCAGCGGCCCGTTCCGCGAACCCGCACTA
TACTGCGGATCTCTATCCACAGGGTTCACAAGATCCACTAGCGCAGCTCTGTTCGTGTGGCTCGCACGAAGCGCCAGAGGAACACGTTCTTCAAGCTCCG
TTTACGGTAGGATCTGGTTACGTTTGTGCGCGCTTGAAGGAAGAAGCAAAGGAGCCACATAACACCTGCTGAGAACGACACGCCATTTGAAAGCTTGCCG
TGGAGA