Description :
Non Conding Region
Location :
contig_1:75015- 77136
Sequence
2121 bases(100 bases per row)
TCTCGATCGCTGCGGGTGTTGTAGGCGAGTTTCGCGTGGCGTCTGCTCAGTAAACCACGAAATGAAAACTGAAGGTTGAAGCGTGACATGAAATGAGTGG
GGCCAAGCGCACTTGTATCGGAGTATGCGTCCAGACTTAATAACACTTGGCTGAGCTGAGTTTCCTGGAACGTTTCCAAACTCACCTGAGGTGAAGTTGA
TTCTACATGAACAGTATTTTGGGGGCGGACGCTGAAACATCGAGCTCTGTCGCAGGAAACTACTGCGAAGTAACCAAGTACTTGGTGCGTTTCATTGCTA
CAATTACACTTACTTCTTTCCTACAAAGACCCCAACACTAGATCCACCAAAAATCAAACCGCGAAAGGTTTCAAGAAAATATAATATGGGATCGCAGACC
TGCGTAATTTACCAATTTCTTTGAGTCGCAATGTGTTTAGTTCAGGAAGTGGGGATTTACCGTACAGCGGGTGGATTAATCAAACGCCACCCAAAAATTA
CTAATGAGTTTGGATGAGTAGATCGCAAAATGGAAGCAAAGGTAATTGGAGCTACGAAAACGCATCAAGTTTTTTTTTTTTTTTTTGGGGGGGGTTAATG
AGGTCCTCTGTTCGTGTTTACCTAGAGACTATAGAGCCCCCAAAAAGCGCATCAAGTTCTTGGTGCTTGCGAGGTGAGTTTCTTGCGAAAGAGCGCGATA
TAAAAGGAGGTATACCCTCTTTGAGCTCGCTCCCAAAATACAGTTCACACATCGTTGGAGCGCACCGCTCGAATTAACCATTAAGATGAACGTTCAAATT
TTGCGAAAGATCTGGGAGCTTGATGCACAATAATACTGCGCCTTTATCATACCTATTATTATTTTCTTTGCGTCTATGATGCTAGGGGCTGCTGCCGTGA
CGTCGTCGCTCGTAGTGAAGTCTCTGAGGTAAGTTTTAATTAACGGAAATCGATCCAGCACTTGAAACCCCAAATTCACCATTAATATTAAAACGTGTCT
CGGCACTCTCTCCTATTTCTTCGTACGTAAAGTACAACGGAAAATACCGCATCACCGTCGAGACAGTTTTGTCCACGGGGTACGCCAACTATGGTAACAA
CGAAGCGTCTCTGAGCTTGCGTTCTTGCCGGCGATAATCGTCCACCATTGGTAAATAAAACTGTCTCGCCACTCACTCCCTCCTTTCAAGAAAATGCTTT
ACAATTGTGAGGGCTTTGACTACATGAAGTACAACGGACTATACTGCATCCCCGTCGAGACAATTGTGTTCACGGGGTACCTCCTCGACTATGGTAACAA
CAGCAACGAAGCGTCTTCTGTGCTCACTCATTCAACAGTTTAATCTTGCGATGGCATTTGGAAGCATGAAGATAAAAAGGTAGCTCGTGCAATCCACGCC
ATCCAAATAACTGAACACGATAGCGCAACAATAAACCATTTGGTCAGCTTGAGGCTTGAATTTACTCGCTTCCAAGTTATCAAATACTACAAGGGTTCAT
TGTTCACTTTAGAAAAATAGAACGCCATCGTAGACAGCGTTGGAGCTGAATGCGGTACATGAAGAGACCCCGTCTCCAACATATCATATCAGTTTGTTTG
CACTATCGACATAAAATATGAGAAGCGTCTAGAGTTTGCTAAAATAATACTATTTCTTATGAAAATACCAATAGTCTTTTTTTAATATTCTGCGTTCAAA
CCGCACTGCTCCAATATTTCTTCTGGAATGCCTGCCAGACAGGTATTGTCTTGCATTTAGTACATAGCAAGTATCATATAATACATGTAGAAAGAGTAGA
CGGCTTCGTTCTGGGTCCCAAATGGAAATTGTAGATCAAAATGAGATCAAACTAGAATGCATCACCTTGTGTATGCCTTCACGACGTACTTCTCGTACAT
TAAAGTCGTAGGCAAGAAAGAAAGTGGGTGTTGCTTATTTCATGGGCTTAGCAAAACGTGAAGCGAAGCGATAAACCGCACTCTTAAAGAATGATCCCAT
CAGTTGTTCAATGTCGACTGGCTGACAGCAGCCTTCTCTCCAAAACTTAGCAGTAGTAGAGACCGCCGAATGGGATGCCCAGACCGCAGCCGCCGCCGTA
CAGACCAGCACCATACATGTT