Description :
Non Conding Region
Location :
Scaffold_1:74908- 75428
Sequence
520 bases(100 bases per row)
GCGGCAATCGCGGAAAGTAGCGCAGCTCTTCTTGGCGTTCGGTTGCTCACTGGTCAATCATCTTGAGTGCTTGGAGAACTTGGTCGTGGTCCGCGGCAGG
GGTGTATGACCGAGACATCGGTGATGACTGAAGTGAATTGAATGGGCTTGAAGATGAGTGATTAAATTCATAAGGGACAAGTATGGATTTTGCTGAGCAA
TTGTATAAAGATCGAGCAAAATGGAGATGATAGAGAAATGGCTGTAAACCACCAGTTACCAAGTCAATAACTGTTCCACATGGGTGATTTGGTTGGACAC
AAAGCAAGACATGTGGTGGTCAGTTTCTGGTCAAAAGGTCTGTTGGCTAGTAGAAAACACATGCTTTCTAGTCGATTCTACAAAGCGTTGACCAGAATCA
CCAGAAGTATCATGTTTGACAGCATCAAGAATATACAAACAAGAGCGAAATTGTGTGTGCCTACATATAACTTGTTAGAGTGTTTGTGAGCTATACAACC
CTCCACCAGTCATAACTGCA