Description :
Non Conding Region
Location :
Scaffold_1:74896- 75802
Sequence
906 bases(100 bases per row)
AGTGAATTTGCTTTGGGACTCAAAACGCCCCTATAATTAGCTACCGGATCAAGCAGACTACTAACTAACTAACGTTAGAGACACTGACTAGCTAGCTAGT
TGAAGGGGACGGACGAGGCGCTGAGCGATACGAACACCGACTAACGTTAGTTGAAGAGCTCGTTGAATTGAATACTAGCGCGGAGTGTCCACAGAGTCGA
GCTTTGACTTTTTGTGTTTACAGTGTTAGCTAACTAGTGCTTTAACTAAAACGAGTAATCGATAAGCAGCCCTCATCACAACGCGTAAAGGGCTTCGAGG
ATGCATGTGGCGGGAAGATGCACTGCGATTTGACGGGTCTTTAGTCTTTTCGGGTAAACGAGTTTTAACACCGCCGTCTAGTCCATCACGACTAACTTGG
TATTTTGGTTGATGGACAATACTGTCGTCGGTGATGTATAATGCTGTCGGGGGCGGGCTTGTCGATGGCCGAAATGGCGGTGGCGGGAAACACGCGTGTT
CTTTTATTAATTCTTTTATGTCTTTTAATGTTTAAAGCACGACCAGGGACAGGGCAATTTATCCGGTTCCCGCCGGGAGGGCGGTTTCGCGCCCGTTTTC
TCTTCACGTGGGAAACGTGCATTTTACGTGAGAAGCGTGAAAAACACACGTGGGAATTTCTTTCGTTCTTCATCCCACTATACGCGCGGCGCGCGCGGTT
TTTTAGGCCTGCGACGTGTGAAACGTCAGCGTGTTTCCAGCCACCACCCGGGCTTCGAATTTCCGCATACGGTATCCGGATGATTGACCTCGCGTTTGAT
TGGTGGAATTGCGCGGCGAAATCCAAATCCCGCGATCTGATTGGTCAAAAACCTGTGGCCCGCGCACCGAATAATCCGGTCCAAAGTTGATTTGGGTTTC
GTAGTA