Description :
Non Conding Region
Location :
Scaffold_1:74831- 75426
Sequence
595 bases(100 bases per row)
TGTGTATGAGGCAGACTCGGGTGATAGAAGAGGACGCGAGGCGAGGCGCTCGTGCGGGTCGAGGGCGGGCAAGGAGCTCTCTTCTCGTCACACGTGATGT
CGCTGGCTCGTTTTGTTGTTTGGGGCCGGACATCATCCTGATTTTCGATGTAAATAGTGTTTACCACACTAAATATTCTAAATTAAAGAGTTGGAAACAC
AAAGCTGAGTAAAATATCCTATTTTAGCTAATTGCCACACTATTCTCTAGCGTTATTCAAAAACTAAATCCTTGAGTTCTTCCTGACAACTCTCGAAGCA
CCTGACAGTCGTGAATCGAGAGCCAACGGAGACATCCACGACAAGCAAAGTGCGAGTTGAAGGAGCTTCGGGAGTTGGTGCTGTCGACAGTAACGCAGTT
AAGACGGAGCCGTCATACCATTAGACCCGCACAGAATCGTGGACTTGGTGCAGTTCACGAGGGCAAGCAATCCCGCAACGAAAGGCATCATAAAGATGTA
GAAAGCGATTGCAGTGGAGAATGCGCGAGACTGGATGTAAGACTCTCGCTATATCTTTGCAAGGCCATCTGGACGAGCCGAGAATGAAGAGGCGA