Description :
Non Conding Region
Location :
Scaffold_1:74572- 75994
Sequence
1422 bases(100 bases per row)
CGCCGCGGGGAACGTTCGCGGCCAAAGGGTGTCAAGAGGACTCGGTGCTGGTCCTGTTGAGATCAGTAGTTGTTGCCAGTGGTTAGCGGCTCTAGCAATA
TATGATCTTTGCTTTTCGTCGACATGGTAGAGCTACGGCTAGTCGTCAGCGAGTTCCAGCGCGGTGGTGACGTCGCGCTCCGGTTGCACGCCGCGGGCAG
CTTGAGCTCCGTTCGAATCGCGCACGACACCGCTCCATCCTAGGTGAAATCAGCTTCGCCTTGCCGCACCGGAAGCAGCGGCGCAACGCCGGTGTGGATG
CTGCGCCATTACCAATAGCCCTCGGCGCCGGAGCCCTGTCACGGAGTCCGCCCAGCTGTCGCCGCACCCTTGCAATGGTGGGGCTCCTTGCAGCACCGCC
GGGATTTTCTGCGTTGGGTCCAGGCCCACCAGCCCGCGCTCGGTAGAAGACACATTCTTCACGCGCAACGCGTCACGACAAGAAGCTTTGCCGAGATGAC
AGGGCGGAGCTGGTGCATGCAAGCAGTCATGGACCATGACGGCTAGGTTCAGTAGCTCGGCGACCGAGGCACGGGAGCGCATTCAGCTGCGAGGCGGTCA
AGGTGCTGGCCCCCGCCAGCTACAGCCCGCCGCGCTCAAGTTGCAGCAATGCAACACGGTCTGTATACCAGTCGTGTGCTGGTTCTGGTGAGCAGGCATT
GCACCTGCGCTGCAGGCTGCAAACAGCGGCCTTCATTAAAGCAAGACCCCTCCCCATGAGTTGCTGCTACTGTACTGGGAGCTGGACCTGGTGCCACGAG
CGACTTGGTAGGGCTGGATTTTGCCAACGGAGACTTGAGCGGTGGCACCGCCATCGGCGCCCAAGCAGCGTTGAAGTTGGCCAGCTGGAGGATTTGCTGG
TCAGCGCTGGCCAGGAGGGACAGCCCAAATGCGCGACGTGCGCCAGAATGTCCGGCCCGAAGCTTGCGGCCCCCGCGACGAGCGCGATACGAGCAGAGGC
GCCCCAGCTGAACCGGGGGAACTGCACCGTCCAGCGGGGCTCGCGACGCTGAACCCAGCCGCGCGAAGCAACGTGCAACATGGAACGTCGGCGTACGTGG
CTCTGTGTGCAGTATGCTTGGGGCACGTCGGCGCTTCTGGTGGTGGCGTCGAGAGCCGATACAGTAGGCCCCACTGAAAGCGGAACGGCGGTATGCAAGC
AGGGGCGGGCGGGCGCGACCTCACTTCCCAATTGGATCTCGTCCGGGCAGCTATCTCTGGCTAGCTCGCTCTACCCTCTAGCCCCCCGCTCCGATCGCAA
CGCCCCCACCATGATGCACCGAGTCCGCATGCCCCCCATGCAGCAGCAACCTCCGCTTGGTCTCCACCCCGAGCGCGGCCTGGGCCCCGTCGCCGTCTCC
AAGTCGAGCTCGCTCCGCGCGA