Description :
Non Conding Region
Location :
Scaffold_1:74456- 75417
Sequence
961 bases(100 bases per row)
GCGCCCCCCGGACAGGATCACGTGAACGCCACTGCGGTGGCCCACGAGATGCTTTATATTTAATGGAGCCTGTTACGGTGGCTCCGTCGCGCCGCTTAAT
TTGGCTGAGCCCTGGGCCATGACTCCGTCTTGGTGGGTGGTGAACCCATATTCAGTCCTCGTCGTGTCACCCAAAACGTCAGACGTCATTTGATTGGCGG
AAAATCTTCATAATCGAGTATAATTGGTCATAATTCAGGGGTGATCCACTCCCTGGCCCCCTTCCCCAGCGCAACGCGTGACAAGTCTCGCATCTGAGCA
TGGACGTCGTCGCTGTTCCAGCGCCGCTGGCCAGCGCCACCAACGGCCACGGACACCACGAGGTCATATCTAACGGCAAGCGCAAACTCGAGACCGACGG
AGAGGGGCCCGCTCCTCTTTCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAGAAAATGGCGACAATGCATCGCCGAGTCTGAGGCACGAGCGCGCGCTGTG
CCTCTCGTGCGACTTTAGCGGCCGCCGCGAAGACGCGCAGGACGCGGCCCAGTGTTTCCTCACGCACGCCATGCTCACGAACCACCACTTTGCTCTGCTG
CCGCGCAAGAAGCAGCTCTTCTGCGCGCGCTGCCTCGACTTTGTGTACCCCGACGCGCTGCTCGCACTCACGCAGCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTTCACGACCAGAATGGCGTTCACGCGGCCCGTCATCCCCACCGACGCCCTACGCACCACAGCACG
CGTGCGCCGTCCCTACGCCGTCGACTTATGCGGTCGTCGGCTCGCCGCGGACTCGTCAACA