Description :
Non Conding Region
Location :
Scaffold_1:7433- 7586
Sequence
153 bases(100 bases per row)
AGGTGGCGGCGTAACGGTTTGTGCTGAACATGCTAATTTTTTCCTGGTGAAATTTTGGCTTAAGGACGAAAGTGCCCGATGGACCTCTTCGTGGCGTAGA
CCGCTCGCTAGACCTCCCTGGATGACTGGACTACACACGCAAGAGGGGCTACC