Description :
Non Conding Region
Location :
Scaffold_1:7429- 7559
Sequence
130 bases(100 bases per row)
GAGCCCAAGTTGTCGATTTTGCGTGGTGACGGCCCAAAACCAAGGCTTCGCGTGTCGATAGTATAATCATGGAAGCAAACGTATTCGTACAAAAGGAACG
AGCAAAGGCTCAGTGCGCATACTCCTCGCC