Description :
Non Conding Region
Location :
Scaffold_1:74107- 74389
Sequence
282 bases(100 bases per row)
TGCCGAAAGACGGCATCCCGAGGGAGCTCTTGTTAAATGTATAGATCTTAGCTGCTGAGCAAGTCCTTGATACCCTTTATCCGCTACGAGCGCCAAATCT
TGCGAGAACTAGGCATTCATAGGGCCGCGTCCTTCGAGCACCAGATCTTGACCTGTCTTGATACGCATCTTTTGATGAAACGCGAGCTTTTGTCGGAAGA
CTTGGATTTCTGCGTCGCTTCCTTTTGCAAAGCTCGTGCAGTTGATGGCGAAACCGCGCGGGTTCAATTACACCTCCACCTT