Description :
Non Conding Region
Location :
scaffold_1:7396- 10341
Sequence
2945 bases(100 bases per row)
TTGACGCAGTCAAACTCCTGATGCGAATGTTGAAGGGAGCAGGAATCGTACTTGGTTCGTTCAACGCGAACGAATTGTTCGACCTGGCGTTGCCGGTCAT
CAGGGAAGCTACGTTAAACCTGTTCACGAAGCTGACGCCCCTTGTCGGAAGCGTCGTCCCGGTTCAACGTACAAGACCAACACCGACTCGCAGCCAAACT
GGATCGTCACAATATGCCTCAGCCACATCGGAAGCAGGATCGGACAGCTCGATCAAGCTGCAGCGGATGACGCTTGGACCAGCTGGAGCAACCATGCTAC
AATCGCGAAAAGAGCGATCGGAAGCCAAGCCGACGGAGATCGTACCACGCGATCCAGTCCAAGCGCCGCCCGAACGCATGCAATCATTCTTCAATGCAGC
GATGGAACGTTTCCTGAAGGAACAGCAAACGACCGTGACACCGCCAGCTGCTGTTCGGAACAGTCCAACCGGAGCTCAAGACGTGGACATGGAGTCCGTG
GGATCGAACCGCCTGGATCATTCGCATCCAAGTGAGTACGATCCGGACGACTTGAACGTCGGTGTTGCTCCCCGTGCCGCAGTCGCTTCTGCTGGAGCCA
CGAGCGGCGGAGCACTCTCTGCCACCCGCATCAGGGTTTCTGCGATCTCGGAACTAAAGGAATTCTCCGGGAAGGATAACGACGAAGATCGCGCTAGAAG
CTGGTTCAGCAAACTGAAGTCTGCTTTCACTCGTGATCAAGCTCCAGACGGCGAGAAGTGTCTGGTGTTTGGAGATTTGCTCACTGGTCCAGCGCGCAAC
TGGTACCGACAGCTAAGTCGAACGACGCGTGGCAACTGGAAGGAGCTATCCAAGAACTTCCAGACCCAATACTGCGGGCGTGGTGTATCTGTCGCGAGAC
AGTATTACCATGCGCGGAAGAGATCGGACGAATCGCCGTTGGAATATCTGCACCGTTTGAATGTCGCGGGTTTGAGAGCTCAGCTCTCGATCAAGGATGG
ATCGATCGAGACCCGCCGTGAGCATGTCGATCACTTTATCGAAACGCTCGACGATCGCGATCTGGCCAGCCAACTGGCGCTGCTCAGAATCCCGGATGCA
GACACTCTCGAAGAAACACTGCGATCTCGACAACGCGCGAAGGCGAGGCAGGGAAAAACGGTGTATGGATCCATCAAACCCAAGCAGAAGACGCCAACTG
GGATCACCCCATCCGCCAACGCTCGCGCGGTTCGTACAGTCCGTACAACGGCCAACTCGAGTGAGTCCGAACCGGAAACCAGCGGATCGGAAGGAGAAGG
CGATCTGCGCAAGGTGTACTTCGCGGCAACGCCTGACCAGCCGACTCGATTGCGATCGGATCAAGATCAACGTCGTCTTAGTCGAGACTCCAACGACCGT
CGCCTCGATCGTCCCACCGGACTACCCGAAGGAGACATCCCGCGGAAGCCATGTTCCCACTGTGGATCGGCGAAGCACACCGATCTTGGTTGCTGGAAGC
GTCTGACGTGCGAGAAGTGCGGCAAGAAGGGTCACCCTACTGACCGCTGCCTCTTCGTCTGCAAAGCCTGCGGCGAGATCCACGGAGCTGGAGAGTGCCC
GATGGAAGAGTTTTACAACTTGATCCGTCAATGGTATAACCCGAACAAGCACGGTGGAATGCTCCCGCAAGCGGCCGAAAAAATGTTAAACTAGATCGCT
CGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAATTCTGCATCTATGCATATGTCGAAAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCC
GACCGACAATACATGTGAGCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCCATCAAGTCGACGAATACTCGCGGTCGGAGGTGACGATGGCTTTG
GATCTCCTGCACCGAGAGTCACAAGGATATTGGAAGTACCATGTGCCGGACAAGAAGTTTCGGCAGGCGAAAGCCGTGGGGAAGATCAACAACGAAAGAG
CCACATTGCTGTTTGACAGTGGCGCCGAGGTATCCATTCTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGATAACAGTCAAGAGTTGGAATG
TGAAGGAGTTGGTAAGAATCCCTACGTGGCGGATGGACGTACCAGAATCAAGATCACGCTCGCTGGATCACTGGTGTACTACTTCGACGCATGGGTCGGT
CCACCCACCGGTGGCCAAGACCTGATCCTGGGGATGGACTTCATGGTGCCAGCTGGCATTCGCCTCGATCTGGCTGACGGTTAGATAAATCTTCCGGACG
AGGTGCGGATTCAGATAGCCGGTCGACGTCAGCTCTACGGGGAGAAGGTGTCGCAAGTCAGGCTCGGCGAGCACTGTCAGTTGGAAGTCGGAGCGTCGGT
CGAAGTCCGGAAGGGTTTCATTCCGTCGAGCCACCGAAAGCTGTGGGTTACCCGAGGAGAACGATGGGTGCCGAGTTTGATTGCTGGACTAGGGAAGACA
CGCTACCTGAAAATCACGAACATCAGCAATCGGAAGTTAGTGTTGCAAGATGATGCCCACATAGGCATGTGGCTCGAAGGAGGACGCGTACCTCACGCTC
CTGGTTTCGTACTGATCGGGTCACGCCGGTATGCTGAGTGGCAAAACCTAGCGTTTCAAGCCACCACAGATCAGCAGCCCGAGGAAGAACCAGACACGAG
GCCCGTTGGACCGATGGTGGACCGACCCCAGTACGTCACACCGACGAAGATCTGGAGTCGAGACGCCGGGGCGCCGAAGGTAGCTGTCGCTCAAATCACC
GAGTCCCGCCCTGTTGAGACAAAATCGAGGACAAATACCCCCGGGATCAATGAGGCGCACGAAGAGGGTAATCCGATTGCGACGGAGATGTCGTCAGACA
GAATGGAAAAGCGAAGCGACGGGATGCCTATCGGAAGAGCGCCCA