Description :
Non Conding Region
Location :
Scaffold_1:73725- 74156
Sequence
431 bases(100 bases per row)
GTGATGAATATACCTAGCAATCAATGGAAGGGGACAAGATTAGAGAGGCCTGGCCCAGAGCTACGACGTCATGACGATCGCAGCTTACCTGTCTGAAAAG
AACTGAGCGAGTATCGGAGCTGTCGGTAATTTTCAGAGCCAACCACAGCCAACCACAAAATTTCGTGTGGCGACACACAACAatggtacagtgtaccgAA
TGTTCATGTAATCCAAGCCATCATCCCGCAACATAACACTCAAATGGTAGCAACATAATATACTATGTTGCACTCTAATCAGATGAGCAACATGACCCAA
CAACGCGCGACTTTCTCTCTTGAAGCGGCCTTGATCGCATCCTTCCTTCCGCGCGGTGCCGCGCTGGCCTCAGCTCAGTCTTCATTTCGACGTCTACCTA
CtaaggagaaggaagaggagaaagaaACGCA