Description :
Non Conding Region
Location :
Scaffold_1:73629- 74411
Sequence
782 bases(100 bases per row)
GTAGCTGCTGAGGGGAGAAGAGGAGGAAAGGGGGGGATCTCTCTGCGCTCAGCTGTCGAAGGAGGAGAAGAGAGGGCGGAACCAAATAACGCGAGTCACA
GGGGGCAAAGGAGGGGTGGACTCCTCACAAGTGCCGTAACGAGAGCCTTCTTCGCCTCGCTGTGGTTCTTCGTTTGTGCTGCTGCCGCCGGCAATCGCCA
GCCAAAAGCCAACTCTCCCCCCCTTTTCCCGTAGTCCCGGTAGTCAAGACGAAACACCCCTTTTCCACGCCATACTAAAATCAAGTCTCAAATCTGACGT
GGTAAATGCCTATCCCTCATAAGCCGAGAAAAATATTCAAGAGGGATGGATGTCTTCCATATATCTACAAACGGCGTCGAGGTGGTCATTGCAGTGCACT
GACCGCCTGCATTCGCAGTGAACGTGCGCCGAGATGGCGCCATTACCAATGATCCAATGATCCAATGTTTCCTGTCGTTTCAGAATGTCGCTCACAACGC
CATGACCGTTCGAGTGACTTCCTGGTCACATCTCAACCGGTATAGGCAAGTCAGTTCATAAAGCCAGCCGTCGTCAGAGTGCAAAGCAAACGCAGCAGCA
GGCTAAAAATCGTCTGCCCGCGCGCACAACTTGAAAATGCACACCAAGCTTCACGCTCTGAGCGCGTACACATATGCAGCGATAGATTGATTCAGCCCAT
AGTACACCATATCATGCTCCAGCTTCCACGTTGAAGAGGAAATGGCTACACCTGAGCCTTGAAGTTTGAAAAGCTCCGAAGC