Description :
Non Conding Region
Location :
Scaffold_1:7358- 8119
Sequence
761 bases(100 bases per row)
AGTTGCGACGTCAGCGTCGGAGGGGAGACCCAGAGGGTCAGACTCAGAACCGACAGCCAGAACAGCAGAAGTAGCGTGGCCGCAGCCCCGGTGCATTGGC
CCTGACGCAGCTCCCAGGCGCCGCGCCGCAGGAACGCCGAGGCGCGCAGCTGGGCAGCAGTCCCCGACTTGGCCATCACGTTGAGATGAAAATGATAATG
AAAATGACTCGGTGTTTGTATGGTACACGGGGTATGTGGTGCACACCAAGTATAGTTTTGATGCATGGACGCCTCCATCCATCTTCTTCTCAAGATGGCT
GCAAAACTCCTTGCTGCTTTCATGCGATAGTCGTATAACAGAGCTGAGCAACGATATGTGTCCGCTCTCGCGGGTGAGTGAGTGGAGGTCGTTAATGATT
ATGTAGGTACTGGCGACGTGGGTTTGTTGGGGGGGGGGGGTCAAATTTGGGATTTCGTGGTTCATTGGCTTGTACCTACTGCTCTACTTTAGAGCCTCTA
TGGTCGACAAGTCGTCCACGCGCTCTAGTGTGTTGGTTGCATCGACAGCGATGTCTCCGTCATCTTGCCCCGGCGACTGTCCACAACACAAGATTGCGTC
ATTGCTGGAATGATGCAATCCCACGCATGGATGAGCTCGTTTAACAAGGGAATTCTATAAGCCTGTGGTCCGTAGACCCACCGTTGGCGATGCGTTGAGT
GGGGCAACTCGCTTTTCAATTTACCTCTTAACCCCCAGCAAACCAGCACACTTTCCGATCA