Description :
Non Conding Region
Location :
Scaffold_1:73554- 73694
Sequence
140 bases(100 bases per row)
gactgacacgtataaatgccttgtttgtatagaataggagaggcaaattataaactgtggaaggttattggatagatacatcgtaattgacgtcgaagtc
tggttttattgttgaaaatgcccagcataaatacgaaact