Description :
Non Conding Region
Location :
Scaffold_1:73517- 74252
Sequence
735 bases(100 bases per row)
TTGCCAGTGAATCGGGATGGGGTTGAATAGCACAAACAATCACGTTTTAGCGTATTTATTAGGTGTGGTGAACCCCAATTGAAAAAAAAAATCAAATTGA
TTCAATTCCCTGTTTGAATTGCCGATATTAGACCATGGCGGGTACAGTTTTCTCAGGGTATGTTGTCTGTAGGTGGAACGCTCGGGAGAACACATTACAC
ATAGAGTTTGACATGCGGTTTTGGGCGATGCCGAAGTTATTTTCGGAAAATATACCCCTTTTAGCAACTGAAGGCGACCAATCGCCGCAGATGCTACCAT
ACTAGTAAAATAATGGTATTGTGTTCCGATGGGATACTAAAAAATAATTTCCCAAGCCTTGAAATACGATATTGCATTGTCGGCAGCCTCGCCTCCACAA
TGGACAGCAGCTCAATTACTTATGATGCAATTCAAGTAGTGCCCATAACGCCCGGATAAGCTTCTTTAACTACCACCAAGTTCCTCCCACAAGTTCAACT
AGTTTATTAGTATGTTGTAATTTACAACCTTGTGGCTCTTCAATACCTAATGTATAAGTAGGTGGGAATATTCAACGAGTGCAATACCGACGATATTCAA
TTGCATGAAGCGTCAAACTGTATGAGTCATACTAGGGAAAGTGCATGGACGCAATACAGTTTCATTTTTCCAACACAAACGGATTTCATTAAAGTCGTCG
CGCGACTAAACAGCTCACTCATGGTTTTACCAGCT