Description :
Non Conding Region
Location :
Scaffold_1:73371- 73680
Sequence
309 bases(100 bases per row)
CAGTAGACAAGACAAGTAGGTTTCATAGTATTTATTCACGAAAAACAACAACGATTGCAGTTGAGCTTGCTTCTGTCGCAACGGTGTCCATAGTGCGAAC
GGAGCATCGAATGTACAACATGCCGAGTCGATAGCTTGTGTCAAGGGTCTCTCGCACACACCTGTTTCCAGTTGAACAGAAAATGCCGCCCGACCATCGA
GTACGTCGGACCAAAGGAGACGCGGAGAGGATGAGCGACCACTCAGTATTTCATGCCAATAAGAAAATCGTGTCGAAAAGAGGGGTTCGTGCACACCGTA
AGGAAGCAG