Description :
Non Conding Region
Location :
Scaffold_1:72999- 73112
Sequence
113 bases(100 bases per row)
CTGAGCCTGTGGCGTTCCGCGAGCAGATGGCCGTGCTCCAAATAGAGGCTCGTATACTCAAATAAAGTAGTTTAGTCCGAAACTCCTGTAAGTTCTGATC
TTTTGTGTTACTT