Description :
Non Conding Region
Location :
Scaffold_1:72949- 73119
Sequence
170 bases(100 bases per row)
AAGACATCCTCATGTTCCTCCTTTTTGGGCTCGGAGCATTCGCAGCATCGTCATCTGCATTTTGGCTCCAGCAGCAACTGAAGAAAGCAACAAATTTTGG
CTCGCTTAGCATTGTTTCTTCTTGTCGTGCTTTCCTGATTCAAGCAGCTCTGTTCTCATACTCCTCGCCT