Description :
Non Conding Region
Location :
Scaffold_1:72932- 74624
Sequence
1692 bases(100 bases per row)
TTGATTGACTCAACTCACCGACATTGGCGTGGATCCGTTGGGCAGGATCGTGCACGTGGAGCAGTCGACGCCCGATTTCGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCGAGTGCGCAAACGCCGCTTCGCTGTCTTTCGTCGGGTCGGAACTCGTCCCCATCCAATGGCAGGAGCTCCCCAACTGAGCTGCGACGAC
CTGCGTACACACAAGAGCACTATTACATCCACGGACATGGCCTGGACGTGGGATACACTGAGTGTATTGCTACGCACCAACACATTCGCCCCATTACCGC
CTCTGAAAGTGCGGAAGAAAGACACATTAGGGCACTCTTCCATCAATGTGGAACCTGTGGCTAACAGCAGCACACACGCACCTGCATTTCCGACGCGCTA
GCGATCGTATCTGTTTTTTTTTCACACCAGCAAGCAAATGTGAATATTGCGCATGCATTGAGACTCATGCAACAGCCAGCACTCTACCGCAAACCTTTTC
ATCCTCTAGAGTACATTCACAAGTTCATGAGCACAAAGCATACGAATCAGCGACTGTCTTTTTCCCCTCTCTGCATACATGTAATGCCCAATACACGCAC
CCCTGGGGAACTCGGCGATCTCGTCGATGATGTCGACCGCGACGATCCCCACACCCACCACCTCCATCTCGCCTTGCTCTCTTCCACTAAATTTTGCGTC
AATTTTTTCTTCTTGTGCTGCTCATACGTTTCGTCCGTTGCTTCAACAGCCTCGACTAAGTGCGAAGGCTTTAACAGAATCAGAATTCTACTGTCACACA
TAAATGCGCACCGCACACATTGAACGTGATTATGACGCAGTTGAAGGTGGGTACAAAGTGTTTGCTCTCTCCAATACACTATCGATAATACGTCTGCATA
ATTAGTCTAGAAAAAGTATAGCAGCACTTGAGGCAACGATAAAGCAGGAATGCCGCAGCGAAAGAACCGCGAGTGCCATTCAAATGGATGGACGGACATG
CATGTACAGGTAAGGTGCAGAGTGGAATCATGGATCCGCCCTTCGTCGCCGTCTGAGTTACTCCGCCGTCTGTTGGATCGAGAAAGATCGAAAGGCACAG
GGGCCTGGAACGCTTATGCAGCGCAAGGATACGCTCGCTTTTGTCTCCCAGTATGCCGCCATCCACGTCATCAGGACCAATTTTTTGCCAGTTAGAGGTA
GACATGCCATACACACTACAGACACTTTGTCACACACACTATGCGAGTGTCTTATTCGCAGTTCTGGAAAAGTCTAGAAATAGAATGCCCTGTGCGGAGC
CAATCACTGTCCCTCTGACCTTTCGCTAGCCAATGCACGTTCTCGAAAGATCCTTTTTGACCAATCAGGAGCGAGGAAGGTGCCCTTTCAACGCGTATAC
GTAAACTAACGGACTTTCGCACAAAAAGGCAACGTCAATGCCAATATGGCCGACGAAAGAATCCGCCGATGCGCGTTACAAAGATGCCGGCATTCTGCAA
TTCACTCAGTGCCACAACAAGCGAAAGAGAAAAACCAGCGACACAGCTAGAGAACAGCGACCGACAAGATGATGCCTGCGCGACCACCAGAGAACAGCAG
CAACAATAACAGCAGTGATCCGTCCACGACGACGGCGCGATCCTTGACGGCGTTTCTGATTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNA