Description :
Non Conding Region
Location :
Scaffold_1:72861- 73131
Sequence
270 bases(100 bases per row)
GATAATTTTTATACCCTGACGTATTAAACGAATTAATCATTCACCTCTGTTTAAGCACCTTTCATACCTTGTACCTGATTATTGGTATGCCAAAATCTGT
TTATGGTCGTTAAAACGAGGGACAGGCACACACACCGCGAGCTATAAATGCATCGGCATCATTTTGACGTAAAATTAGACTCCGGATAAGAAATGGAATC
CCGGATAAGGTTTAACCCAGACAACCTCGTTATCCGGATAGCTGTGGGTAATTTGAGCGGAGATTTCCAG