Description :
Non Conding Region
Location :
Scaffold_1:72806- 73612
Sequence
806 bases(100 bases per row)
CGCTCAGCGGTGGAGACCACGAAGCGGCGAGAGGACCCCCCGCCCCTCTTCAGGACCAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGCGTCGCCTCGT
GTTTCCTCGCTTGATTTTCGGCTCGCTGCTGGCATGGCGTCGAGTGCTCTGCTGGCATCGAAGCTTAGCTCTAGGACATTAATCCGGCTGAATATGTAAA
CGCGGAACGCGACCACATTTGCCTCGTACACTTTGACTTGCGTGCGTCCGCGTGATGCAATCGGCTCCTGCATGCCGATCCCACATCTTCTTCCAACGTT
GGGTGGTGTTGCTGCATAGCTCTGCCGAGCGCGTGGTGGTGGGTATCTCCGTCTCCACAGTGTGGAGCGTGTGGAGTCCACACGCGTCGGAAACAGAACC
ACCGTCGTTGTTGGTCACAGCATCGCGAAGATGCAAATCCTGCCAGGCAAGACGGACATAGACCGCTGTGTCGAGTGCGTTGCACCCGTCAAACCGTGTT
GCCTTTGACACCAAGCAGAAAAAATGATGTGCATCAATTTCGCCGCCATCCACCACTCGACACAGGCACATTGGAAGAAGCTGCTCAATTCCCATGTTGA
AGCGTTTACGATACTATAATGCAAGGTCACTCTGGCCGTGGCCGTCCACGTGCACATGCTTCTCCTCCACCTACGGCCGCGCATATTTTTCTACACTACA
TGTACTTCACCACTAACTATATAGTTCACGGTCGGCCGCGTGGTGCGTCTTGATACTTGCGTCGCCGTCGTCATATTTCCCCGAACGGCTGAAGCGAATG
GCGTCT